ID: 1040826276

View in Genome Browser
Species Human (GRCh38)
Location 8:51623848-51623870
Sequence CTCTGTGAGGCCAAGGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040826270_1040826276 15 Left 1040826270 8:51623810-51623832 CCAGGCATGGTGGGTGACTCACA 0: 2
1: 5
2: 20
3: 104
4: 645
Right 1040826276 8:51623848-51623870 CTCTGTGAGGCCAAGGTGGAAGG No data
1040826269_1040826276 22 Left 1040826269 8:51623803-51623825 CCACAAGCCAGGCATGGTGGGTG 0: 1
1: 1
2: 6
3: 105
4: 760
Right 1040826276 8:51623848-51623870 CTCTGTGAGGCCAAGGTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040826276 Original CRISPR CTCTGTGAGGCCAAGGTGGA AGG Intronic
No off target data available for this crispr