ID: 1040835059

View in Genome Browser
Species Human (GRCh38)
Location 8:51722752-51722774
Sequence GTTTGTCCCCTCATGGAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040835056_1040835059 24 Left 1040835056 8:51722705-51722727 CCTTCTCTTCTTTATGTTGCACT 0: 1
1: 0
2: 1
3: 30
4: 410
Right 1040835059 8:51722752-51722774 GTTTGTCCCCTCATGGAGCCTGG No data
1040835057_1040835059 -5 Left 1040835057 8:51722734-51722756 CCATTCTTCTGCTCTTCTGTTTG 0: 4
1: 8
2: 31
3: 107
4: 820
Right 1040835059 8:51722752-51722774 GTTTGTCCCCTCATGGAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040835059 Original CRISPR GTTTGTCCCCTCATGGAGCC TGG Intronic
No off target data available for this crispr