ID: 1040839633

View in Genome Browser
Species Human (GRCh38)
Location 8:51771540-51771562
Sequence CCTTACTTGCCCCCAAGGAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 106
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 97}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040839633_1040839639 13 Left 1040839633 8:51771540-51771562 CCTATCCTTGGGGGCAAGTAAGG 0: 1
1: 0
2: 1
3: 7
4: 97
Right 1040839639 8:51771576-51771598 CAAGTATGTCACTTGCTTTTGGG No data
1040839633_1040839640 14 Left 1040839633 8:51771540-51771562 CCTATCCTTGGGGGCAAGTAAGG 0: 1
1: 0
2: 1
3: 7
4: 97
Right 1040839640 8:51771577-51771599 AAGTATGTCACTTGCTTTTGGGG No data
1040839633_1040839638 12 Left 1040839633 8:51771540-51771562 CCTATCCTTGGGGGCAAGTAAGG 0: 1
1: 0
2: 1
3: 7
4: 97
Right 1040839638 8:51771575-51771597 GCAAGTATGTCACTTGCTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040839633 Original CRISPR CCTTACTTGCCCCCAAGGAT AGG (reversed) Intronic
900680207 1:3912292-3912314 CCTTCCTTGCCCCGAAGACTTGG - Intergenic
901510568 1:9716347-9716369 GCCTATTTGCCCCCAAGGGTAGG - Intronic
903445896 1:23422983-23423005 CCTTACTGACCCCCAAGCTTGGG - Intronic
904532782 1:31180398-31180420 CTCTACTTGCCCCCAAGGAAGGG + Exonic
907372788 1:54013964-54013986 CCTTCCTAGACCCCCAGGATGGG - Intronic
907486283 1:54780543-54780565 CCTTAGTTTCCCCCAAGAAGAGG + Exonic
908438406 1:64129565-64129587 CCTGCTTTGCCCCCAAGGTTAGG - Intronic
910706354 1:90133699-90133721 CCTTATATGACCCAAAGGATGGG + Intergenic
914717648 1:150265719-150265741 CCTTCCTTTCCCCCAAGGTCTGG + Exonic
915359746 1:155278578-155278600 CCTTCATTTCCCCCAAGGACAGG - Intronic
917569586 1:176251254-176251276 CCTTAATTGCTCACAGGGATGGG + Intergenic
918345301 1:183602578-183602600 CCTTAGATGGCCCCAAGGGTGGG - Intergenic
920309433 1:205040111-205040133 CCCCACTTGTCCCCAGGGATGGG + Intergenic
923994126 1:239472231-239472253 CCTTTCTTGTCCTCAAGTATAGG + Intronic
924158166 1:241202873-241202895 TCTTACTCTCCCCCAAGGTTAGG - Intronic
1065747534 10:28855945-28855967 CCTGACTTGCCCACTAGGTTGGG + Intronic
1070785031 10:79157828-79157850 CCTTACATGACCCCAGGGACAGG - Intronic
1076253013 10:128997780-128997802 CCTTACTTGCTCCCAGGCTTTGG - Intergenic
1076489097 10:130844818-130844840 CCTTGCTTGCTTCTAAGGATGGG + Intergenic
1079837458 11:25351478-25351500 CCTTGCATGCCCCCAAGAAAGGG - Intergenic
1084111175 11:67015103-67015125 CCTTACTTTCCCACAACAATGGG + Intronic
1087045687 11:93842202-93842224 GCTTACATACCCCCAAGGATGGG - Intronic
1106350591 13:28926074-28926096 CCTTATTTAATCCCAAGGATGGG + Intronic
1111853309 13:93604386-93604408 CCTTGCTTGCTACCAAGTATAGG + Intronic
1116955176 14:50915965-50915987 CCTTCCTTTCCCCCAGGCATGGG - Exonic
1118724822 14:68621607-68621629 CCTTACTGGCCCCCAGGGTCTGG + Intronic
1121238311 14:92409628-92409650 CCTAACATGCTCCCCAGGATAGG + Intronic
1122819870 14:104336033-104336055 CATTACTTGCCCCCTTGGCTGGG - Intergenic
1124705986 15:31964620-31964642 TCTTTCTTGCCCACAAGAATTGG - Intergenic
1132383093 15:101380125-101380147 CCTTACTTTCCTCAAAGGACAGG + Intronic
1132760642 16:1507115-1507137 CCTCACCTGCGCCCAGGGATGGG + Intronic
1132841664 16:1981074-1981096 CCTTAGTGGCCCCAAGGGATAGG - Exonic
1134091577 16:11394244-11394266 CCTGCCGTGCCCCCAAGGCTGGG - Intronic
1135936616 16:26785852-26785874 GTTTGCGTGCCCCCAAGGATGGG + Intergenic
1137397466 16:48126261-48126283 TCTTACTTGGCCCCAAGAAGTGG - Intronic
1137734415 16:50713288-50713310 CCTTAATTGACCCTAAGCATGGG + Intronic
1140988105 16:80178673-80178695 CCTTCCTTGCTCTCAAGGACTGG - Intergenic
1142115783 16:88355453-88355475 CCTTACCTGGCCTGAAGGATGGG + Intergenic
1142143810 16:88484318-88484340 GCTTGCTTGCCTCCAGGGATGGG + Intronic
1145765833 17:27457493-27457515 CCCTGCTTCCCCCCAAAGATTGG + Intronic
1149192133 17:54075673-54075695 CCTGGCTTCCCCCAAAGGATAGG + Intergenic
1151815886 17:76471203-76471225 CCTCAGTTGCCCCCAGGGCTGGG - Exonic
1152721253 17:81924809-81924831 CCTGACTTGCACTCAAGGCTGGG - Intronic
1156208259 18:34909271-34909293 CCTTAGTATCCACCAAGGATAGG + Intergenic
1161227122 19:3151854-3151876 CCTTCCCTGCCCCCTAGGCTGGG - Intronic
1161399730 19:4061903-4061925 CCTTGCTTGCCCCCAGTGACGGG - Intronic
1162839989 19:13349344-13349366 TCTTGGTTGCCCCCAAGGAGGGG - Intronic
1163105934 19:15123089-15123111 CCCCACTGGCCCCCAAGGACTGG + Intronic
1164479432 19:28600026-28600048 CCTTAACTGGCCCCAAGGATGGG + Intergenic
1164796468 19:31037512-31037534 ACCTACCAGCCCCCAAGGATTGG - Intergenic
1167743242 19:51337270-51337292 CCTGGCTGGCCCCCCAGGATGGG + Exonic
925614745 2:5734690-5734712 GCTTCCTTGACCCCAAGCATGGG + Intergenic
929049661 2:37825374-37825396 CCCTACTTGGCCCAAAGGAAAGG + Intergenic
931630640 2:64295542-64295564 CCCTACTTGCCCCCTTGGCTGGG - Intergenic
944946389 2:204691385-204691407 CCAAACTAGCCCCCTAGGATAGG - Intronic
1170938159 20:20827491-20827513 CCTTTCCTGCCCCGAAGGACAGG - Intergenic
1172773246 20:37393494-37393516 CCTTACTTGCCCGCAGAGACAGG + Intronic
1174620756 20:51872749-51872771 CATTGCTTGCCCCCAAGGTACGG - Intergenic
1177788054 21:25693958-25693980 GCTTGCTTGCCCCCAGGGCTGGG - Intronic
1184441697 22:44520899-44520921 CCTAAGATGCCCCCAAGCATGGG - Intergenic
950221984 3:11203162-11203184 TCTTACTTGCCTCCAAGCTTTGG + Intronic
952258578 3:31716629-31716651 CCTCACTGGCCGCCTAGGATTGG - Intronic
953349783 3:42206871-42206893 CCTCACCCGCTCCCAAGGATGGG - Intronic
956652166 3:71514199-71514221 CATGACTTGCCCCCAACCATAGG + Intronic
957885166 3:86278314-86278336 CCTTCCTTTCCTCCAAGTATAGG - Intergenic
958443313 3:94182749-94182771 CCTTCCTTTCTCCCAAGGAAAGG + Intergenic
960998714 3:123357880-123357902 CCTTCCTTGTCCCCAAGGTGTGG - Intronic
961222877 3:125213359-125213381 CCTTACTTCACCCCTAGGAAAGG - Intergenic
962351623 3:134660514-134660536 CATTATTTGCCCCCAAGGATAGG + Intronic
963063190 3:141241489-141241511 CCTTCCCTGACCCCAAGGCTGGG - Intronic
964814275 3:160700487-160700509 TCTTCCTTCCCCCCAAGAATTGG - Intergenic
967153034 3:186667161-186667183 CATTTCTTGCTCCCAAGTATGGG + Intronic
975136117 4:70875991-70876013 ACTTACTTACCCCCAAGGTGGGG - Intergenic
981616428 4:146648532-146648554 CCTTCCTTTGCTCCAAGGATAGG + Intergenic
982721968 4:158868874-158868896 CCTCACTGGCCTCCAAGGAGGGG - Exonic
984773065 4:183455143-183455165 CCTGATTTTCCCCCAAGGTTTGG - Intergenic
986223345 5:5790563-5790585 CCTTAGTTGGCCACATGGATGGG - Intergenic
992524164 5:77590480-77590502 CCTTACAAGCCTCGAAGGATAGG + Intronic
993778834 5:92039839-92039861 CCTTACTTGCTCCTATTGATGGG - Intergenic
996921341 5:128771077-128771099 CCATACTTTCCCCTAAAGATCGG + Intronic
998007225 5:138665132-138665154 CCTCAGCTGCCCCCAAGGATGGG - Intronic
998259662 5:140620108-140620130 TCTTAGTTGCCCCCAAGTTTTGG - Intergenic
999284894 5:150388428-150388450 CTTTACATGCCACCAAGGACGGG - Intronic
1001255509 5:170180199-170180221 CCTTACAAGGACCCAAGGATGGG - Intergenic
1013991971 6:116264620-116264642 CCTTATTTCCTCCAAAGGATGGG - Intronic
1015282642 6:131450123-131450145 CCTTGCTTGCCACCAAGGTTGGG + Intergenic
1021361577 7:19719572-19719594 CCTTACTTTCTTCCAAGGGTAGG + Exonic
1021558065 7:21941874-21941896 CCTTTTTTGCCCCCAAGGAATGG - Intronic
1021895157 7:25226770-25226792 CCTAACCTGCCCCAAAGGTTTGG - Exonic
1032100009 7:128967502-128967524 CTTTACTTGCTCCCAAGTGTAGG - Intronic
1033440152 7:141371239-141371261 ACTCACTTACCCCCAAGGAAGGG - Intronic
1034735486 7:153425540-153425562 ACTCACTTGCCCCCAAGGGAGGG - Intergenic
1035790257 8:2297702-2297724 CCTTCCTTGGCACTAAGGATTGG - Intergenic
1035802548 8:2424003-2424025 CCTTCCTTGGCACTAAGGATTGG + Intergenic
1038033199 8:23662631-23662653 CCTCACGGGCCCCCAAGGATTGG - Intergenic
1039328723 8:36513446-36513468 CCTTGCTTGCCCCTAAGAAATGG + Intergenic
1040839633 8:51771540-51771562 CCTTACTTGCCCCCAAGGATAGG - Intronic
1043127574 8:76418993-76419015 TCCTCCTTGACCCCAAGGATAGG - Intergenic
1044112216 8:88289038-88289060 CAATACTTGACCCCAAGTATGGG + Intronic
1049247896 8:141572469-141572491 TCTTCCTTGCCCACAGGGATTGG + Intergenic
1049843296 8:144787677-144787699 CCTTTCTTGGCCCTAAGGAAGGG - Intergenic
1050120623 9:2303621-2303643 CCTTAAGTGCCCTCAAGGCTAGG - Intergenic
1059695174 9:116723809-116723831 CCATACTTGCTCCCAAGAAAAGG - Intronic
1188195726 X:27230520-27230542 CCTTGCTTTCCCCCACAGATAGG + Intergenic
1191878522 X:65821525-65821547 CCATTCTTGCCTCCAAGGTTTGG - Intergenic
1196740610 X:119022069-119022091 CCTCACTTAGCCCCAAGAATGGG - Intergenic