ID: 1040840800

View in Genome Browser
Species Human (GRCh38)
Location 8:51782140-51782162
Sequence CACCCACAGCCTCCGGGGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040840792_1040840800 -6 Left 1040840792 8:51782123-51782145 CCATTGCCAGGAGTGCCCACCCA 0: 1
1: 0
2: 2
3: 22
4: 200
Right 1040840800 8:51782140-51782162 CACCCACAGCCTCCGGGGGCTGG No data
1040840791_1040840800 4 Left 1040840791 8:51782113-51782135 CCTCACAGGACCATTGCCAGGAG 0: 1
1: 0
2: 1
3: 21
4: 187
Right 1040840800 8:51782140-51782162 CACCCACAGCCTCCGGGGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040840800 Original CRISPR CACCCACAGCCTCCGGGGGC TGG Intronic
No off target data available for this crispr