ID: 1040853976

View in Genome Browser
Species Human (GRCh38)
Location 8:51930003-51930025
Sequence GCACACTAAACAAAATCCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040853976_1040853978 -7 Left 1040853976 8:51930003-51930025 CCCTGGGATTTTGTTTAGTGTGC No data
Right 1040853978 8:51930019-51930041 AGTGTGCCTGCAATACACCATGG No data
1040853976_1040853982 21 Left 1040853976 8:51930003-51930025 CCCTGGGATTTTGTTTAGTGTGC No data
Right 1040853982 8:51930047-51930069 AGTCCAACAATGGTTTAACTAGG No data
1040853976_1040853981 11 Left 1040853976 8:51930003-51930025 CCCTGGGATTTTGTTTAGTGTGC No data
Right 1040853981 8:51930037-51930059 CATGGAAGAAAGTCCAACAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040853976 Original CRISPR GCACACTAAACAAAATCCCA GGG (reversed) Intergenic
No off target data available for this crispr