ID: 1040866854

View in Genome Browser
Species Human (GRCh38)
Location 8:52056261-52056283
Sequence AGCAAGGCTGGGCTCACACA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040866854_1040866864 23 Left 1040866854 8:52056261-52056283 CCGTGTGTGAGCCCAGCCTTGCT No data
Right 1040866864 8:52056307-52056329 TGCAGAGTGTGGTGAGCACCTGG No data
1040866854_1040866858 -8 Left 1040866854 8:52056261-52056283 CCGTGTGTGAGCCCAGCCTTGCT No data
Right 1040866858 8:52056276-52056298 GCCTTGCTCCTGCTGGTGAGAGG No data
1040866854_1040866860 -7 Left 1040866854 8:52056261-52056283 CCGTGTGTGAGCCCAGCCTTGCT No data
Right 1040866860 8:52056277-52056299 CCTTGCTCCTGCTGGTGAGAGGG No data
1040866854_1040866861 -3 Left 1040866854 8:52056261-52056283 CCGTGTGTGAGCCCAGCCTTGCT No data
Right 1040866861 8:52056281-52056303 GCTCCTGCTGGTGAGAGGGCAGG No data
1040866854_1040866863 12 Left 1040866854 8:52056261-52056283 CCGTGTGTGAGCCCAGCCTTGCT No data
Right 1040866863 8:52056296-52056318 AGGGCAGGCTTTGCAGAGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040866854 Original CRISPR AGCAAGGCTGGGCTCACACA CGG (reversed) Intergenic
No off target data available for this crispr