ID: 1040870822

View in Genome Browser
Species Human (GRCh38)
Location 8:52098801-52098823
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040870822_1040870826 27 Left 1040870822 8:52098801-52098823 CCTTCTTGCTTGGGGGGCTGCTC No data
Right 1040870826 8:52098851-52098873 ACAGTGCAGTGATGTCTGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040870822 Original CRISPR GAGCAGCCCCCCAAGCAAGA AGG (reversed) Intergenic