ID: 1040870822 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 8:52098801-52098823 |
| Sequence | GAGCAGCCCCCCAAGCAAGA AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1040870822_1040870826 | 27 | Left | 1040870822 | 8:52098801-52098823 | CCTTCTTGCTTGGGGGGCTGCTC | No data | ||
| Right | 1040870826 | 8:52098851-52098873 | ACAGTGCAGTGATGTCTGCTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1040870822 | Original CRISPR | GAGCAGCCCCCCAAGCAAGA AGG (reversed) | Intergenic | ||