ID: 1040870824

View in Genome Browser
Species Human (GRCh38)
Location 8:52098834-52098856
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040870824_1040870828 5 Left 1040870824 8:52098834-52098856 CCCTGAAGAAATTGCACACAGTG No data
Right 1040870828 8:52098862-52098884 ATGTCTGCTTGGTAATCCTTGGG No data
1040870824_1040870829 14 Left 1040870824 8:52098834-52098856 CCCTGAAGAAATTGCACACAGTG No data
Right 1040870829 8:52098871-52098893 TGGTAATCCTTGGGAGAAACAGG No data
1040870824_1040870827 4 Left 1040870824 8:52098834-52098856 CCCTGAAGAAATTGCACACAGTG No data
Right 1040870827 8:52098861-52098883 GATGTCTGCTTGGTAATCCTTGG No data
1040870824_1040870826 -6 Left 1040870824 8:52098834-52098856 CCCTGAAGAAATTGCACACAGTG No data
Right 1040870826 8:52098851-52098873 ACAGTGCAGTGATGTCTGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040870824 Original CRISPR CACTGTGTGCAATTTCTTCA GGG (reversed) Intergenic