ID: 1040870825

View in Genome Browser
Species Human (GRCh38)
Location 8:52098835-52098857
Sequence GCACTGTGTGCAATTTCTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040870825_1040870828 4 Left 1040870825 8:52098835-52098857 CCTGAAGAAATTGCACACAGTGC No data
Right 1040870828 8:52098862-52098884 ATGTCTGCTTGGTAATCCTTGGG No data
1040870825_1040870827 3 Left 1040870825 8:52098835-52098857 CCTGAAGAAATTGCACACAGTGC No data
Right 1040870827 8:52098861-52098883 GATGTCTGCTTGGTAATCCTTGG No data
1040870825_1040870829 13 Left 1040870825 8:52098835-52098857 CCTGAAGAAATTGCACACAGTGC No data
Right 1040870829 8:52098871-52098893 TGGTAATCCTTGGGAGAAACAGG No data
1040870825_1040870826 -7 Left 1040870825 8:52098835-52098857 CCTGAAGAAATTGCACACAGTGC No data
Right 1040870826 8:52098851-52098873 ACAGTGCAGTGATGTCTGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040870825 Original CRISPR GCACTGTGTGCAATTTCTTC AGG (reversed) Intergenic