ID: 1040870826

View in Genome Browser
Species Human (GRCh38)
Location 8:52098851-52098873
Sequence ACAGTGCAGTGATGTCTGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040870823_1040870826 -5 Left 1040870823 8:52098833-52098855 CCCCTGAAGAAATTGCACACAGT No data
Right 1040870826 8:52098851-52098873 ACAGTGCAGTGATGTCTGCTTGG No data
1040870824_1040870826 -6 Left 1040870824 8:52098834-52098856 CCCTGAAGAAATTGCACACAGTG No data
Right 1040870826 8:52098851-52098873 ACAGTGCAGTGATGTCTGCTTGG No data
1040870825_1040870826 -7 Left 1040870825 8:52098835-52098857 CCTGAAGAAATTGCACACAGTGC No data
Right 1040870826 8:52098851-52098873 ACAGTGCAGTGATGTCTGCTTGG No data
1040870822_1040870826 27 Left 1040870822 8:52098801-52098823 CCTTCTTGCTTGGGGGGCTGCTC No data
Right 1040870826 8:52098851-52098873 ACAGTGCAGTGATGTCTGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040870826 Original CRISPR ACAGTGCAGTGATGTCTGCT TGG Intergenic