ID: 1040870827

View in Genome Browser
Species Human (GRCh38)
Location 8:52098861-52098883
Sequence GATGTCTGCTTGGTAATCCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040870824_1040870827 4 Left 1040870824 8:52098834-52098856 CCCTGAAGAAATTGCACACAGTG No data
Right 1040870827 8:52098861-52098883 GATGTCTGCTTGGTAATCCTTGG No data
1040870823_1040870827 5 Left 1040870823 8:52098833-52098855 CCCCTGAAGAAATTGCACACAGT No data
Right 1040870827 8:52098861-52098883 GATGTCTGCTTGGTAATCCTTGG No data
1040870825_1040870827 3 Left 1040870825 8:52098835-52098857 CCTGAAGAAATTGCACACAGTGC No data
Right 1040870827 8:52098861-52098883 GATGTCTGCTTGGTAATCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040870827 Original CRISPR GATGTCTGCTTGGTAATCCT TGG Intergenic