ID: 1040877466

View in Genome Browser
Species Human (GRCh38)
Location 8:52168122-52168144
Sequence GTCCCACGGCACTTGGGGCA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040877454_1040877466 20 Left 1040877454 8:52168079-52168101 CCCTAACTTGTGCTGGGAATAAC 0: 1
1: 0
2: 1
3: 8
4: 100
Right 1040877466 8:52168122-52168144 GTCCCACGGCACTTGGGGCACGG No data
1040877453_1040877466 21 Left 1040877453 8:52168078-52168100 CCCCTAACTTGTGCTGGGAATAA 0: 1
1: 0
2: 1
3: 12
4: 116
Right 1040877466 8:52168122-52168144 GTCCCACGGCACTTGGGGCACGG No data
1040877452_1040877466 22 Left 1040877452 8:52168077-52168099 CCCCCTAACTTGTGCTGGGAATA 0: 1
1: 0
2: 3
3: 23
4: 171
Right 1040877466 8:52168122-52168144 GTCCCACGGCACTTGGGGCACGG No data
1040877459_1040877466 -4 Left 1040877459 8:52168103-52168125 CCAACCATGGGGAGAGCCTGTCC 0: 1
1: 0
2: 1
3: 13
4: 171
Right 1040877466 8:52168122-52168144 GTCCCACGGCACTTGGGGCACGG No data
1040877460_1040877466 -8 Left 1040877460 8:52168107-52168129 CCATGGGGAGAGCCTGTCCCACG 0: 1
1: 0
2: 0
3: 16
4: 165
Right 1040877466 8:52168122-52168144 GTCCCACGGCACTTGGGGCACGG No data
1040877449_1040877466 30 Left 1040877449 8:52168069-52168091 CCAAATTGCCCCCTAACTTGTGC 0: 1
1: 0
2: 0
3: 6
4: 56
Right 1040877466 8:52168122-52168144 GTCCCACGGCACTTGGGGCACGG No data
1040877455_1040877466 19 Left 1040877455 8:52168080-52168102 CCTAACTTGTGCTGGGAATAACA 0: 1
1: 0
2: 2
3: 8
4: 193
Right 1040877466 8:52168122-52168144 GTCCCACGGCACTTGGGGCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040877466 Original CRISPR GTCCCACGGCACTTGGGGCA CGG Intronic
No off target data available for this crispr