ID: 1040881794

View in Genome Browser
Species Human (GRCh38)
Location 8:52213387-52213409
Sequence GACCCTGCAGCCCTTTAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 133}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040881794_1040881803 23 Left 1040881794 8:52213387-52213409 CCCTCCTAAAGGGCTGCAGGGTC 0: 1
1: 0
2: 1
3: 9
4: 133
Right 1040881803 8:52213433-52213455 CTGTGAGGTGGACTCTGAGGAGG No data
1040881794_1040881802 20 Left 1040881794 8:52213387-52213409 CCCTCCTAAAGGGCTGCAGGGTC 0: 1
1: 0
2: 1
3: 9
4: 133
Right 1040881802 8:52213430-52213452 CCTCTGTGAGGTGGACTCTGAGG No data
1040881794_1040881798 8 Left 1040881794 8:52213387-52213409 CCCTCCTAAAGGGCTGCAGGGTC 0: 1
1: 0
2: 1
3: 9
4: 133
Right 1040881798 8:52213418-52213440 GCCACAGCTTTTCCTCTGTGAGG No data
1040881794_1040881806 28 Left 1040881794 8:52213387-52213409 CCCTCCTAAAGGGCTGCAGGGTC 0: 1
1: 0
2: 1
3: 9
4: 133
Right 1040881806 8:52213438-52213460 AGGTGGACTCTGAGGAGGGTGGG No data
1040881794_1040881805 27 Left 1040881794 8:52213387-52213409 CCCTCCTAAAGGGCTGCAGGGTC 0: 1
1: 0
2: 1
3: 9
4: 133
Right 1040881805 8:52213437-52213459 GAGGTGGACTCTGAGGAGGGTGG No data
1040881794_1040881804 24 Left 1040881794 8:52213387-52213409 CCCTCCTAAAGGGCTGCAGGGTC 0: 1
1: 0
2: 1
3: 9
4: 133
Right 1040881804 8:52213434-52213456 TGTGAGGTGGACTCTGAGGAGGG No data
1040881794_1040881800 11 Left 1040881794 8:52213387-52213409 CCCTCCTAAAGGGCTGCAGGGTC 0: 1
1: 0
2: 1
3: 9
4: 133
Right 1040881800 8:52213421-52213443 ACAGCTTTTCCTCTGTGAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040881794 Original CRISPR GACCCTGCAGCCCTTTAGGA GGG (reversed) Intronic
902398897 1:16146781-16146803 GACACTGAAGCCCTTTGTGATGG - Intronic
902686944 1:18083914-18083936 GACAATTCAGCCCTTAAGGAGGG + Intergenic
902715313 1:18268758-18268780 AACCCTGGAGACCTTCAGGAGGG - Intronic
905228284 1:36494111-36494133 CACCCTGCAGCCCTTATGAATGG + Intergenic
907419992 1:54340795-54340817 GAGCCTGCAGCCCTCTGGGCTGG - Intronic
912584483 1:110750047-110750069 GAACCTGGAGGCCTTTAGGAGGG - Intergenic
912712416 1:111959495-111959517 AACCCTGGTGACCTTTAGGAAGG - Intronic
913039691 1:115010450-115010472 GACCCAGAACCCCTTGAGGAAGG + Intergenic
923452588 1:234133445-234133467 GACCCTGCAGGCCTCCTGGAAGG - Intronic
1063371564 10:5525837-5525859 GACTCTGCGGCCCTCCAGGACGG + Exonic
1065961627 10:30738507-30738529 AATCCTGAAGCCCTGTAGGAAGG - Intergenic
1073009945 10:100351254-100351276 GAGCCTGCAGGCCTCCAGGAAGG + Intronic
1076658156 10:132037753-132037775 CACCCTGCAGCCCTTTCAGGAGG + Intergenic
1077136016 11:999113-999135 GAGCCTGCTGCCCTGTTGGATGG + Intronic
1077610855 11:3642385-3642407 GACCCCGCAGGCCTTGAGAAAGG - Intergenic
1081413243 11:42784489-42784511 CACCCTGGAGCCCTCCAGGAAGG - Intergenic
1081749795 11:45501842-45501864 GTGCCTGCAGCCCATCAGGAGGG - Intergenic
1082890240 11:58131265-58131287 GACCCTTCAGTCCTTTACGGTGG - Intronic
1083234478 11:61342867-61342889 GATCCTACAGCCCTTTGGAAAGG + Intronic
1087059154 11:93961576-93961598 GACCATGCAGCCCTGAAGGTTGG + Intergenic
1087061000 11:93977410-93977432 GACCCTGGAGAGTTTTAGGATGG - Intergenic
1088560006 11:111104726-111104748 GATCCTGCAGAACTTGAGGAAGG - Intergenic
1088951023 11:114569968-114569990 GACCCTGCAGCCATGTAGGAAGG - Intergenic
1090356064 11:126141035-126141057 GAGGCTGCAGCCCCTTAGGCAGG - Intergenic
1090497162 11:127224553-127224575 GCCCCTGCAGAGCTTTAGCATGG - Intergenic
1091175415 11:133553342-133553364 GAACTTACTGCCCTTTAGGATGG + Intergenic
1091979805 12:4855782-4855804 AATCCGGCAGCCCCTTAGGAAGG - Intergenic
1094856486 12:34405191-34405213 GACACTGCAGCCCTTTAGTGGGG - Intergenic
1097050834 12:56222107-56222129 GACTATGTAGCCATTTAGGAGGG + Intronic
1097083806 12:56453027-56453049 GATCCTGAAGCCCTTCTGGATGG - Intronic
1098293671 12:68982658-68982680 TCCCCTGCAGCCCATAAGGAAGG + Intergenic
1100329841 12:93572200-93572222 GGCCCCGCAGCGCTTTAGGGCGG + Intronic
1104901487 12:132191772-132191794 GTCCCTGCAGCCCTCTCAGAGGG + Intergenic
1105017769 12:132796512-132796534 GTCCCTGCAGCCCTTCAGGCTGG - Intronic
1108527455 13:51298060-51298082 GACCCTGCAGATCATTGGGATGG - Intergenic
1109053636 13:57517258-57517280 GACCCTGCTGCCCTATAGATTGG - Intergenic
1111967870 13:94879298-94879320 CACCCAGCAGCCTTTTATGAAGG - Intergenic
1113355642 13:109577453-109577475 CATCCAGCAGCCCTTTGGGATGG - Intergenic
1113603575 13:111588663-111588685 GACCATGCAGCTCTGTAGGGAGG + Intronic
1114396892 14:22371887-22371909 AATCCTGCAGCCCTTTTGGCAGG + Intergenic
1119868716 14:77994765-77994787 GACCTTGCAGGCCTTTTGCAAGG + Intergenic
1120765706 14:88324994-88325016 GACTCTTCAGCCCTTTAGGCAGG + Intronic
1122341293 14:101030205-101030227 GACTCTGCAGGATTTTAGGAGGG + Intergenic
1123125834 14:105945360-105945382 GACCCAGCAGCCCTCTGGGAAGG - Intergenic
1123406417 15:20021778-20021800 GACCCAGCAGCACTCTGGGAAGG - Intergenic
1123515747 15:21028426-21028448 GACCCAGCAGCACTCTGGGAAGG - Intergenic
1125584069 15:40807878-40807900 GGCCCTGCAGCCCTCGGGGAGGG - Intronic
1127391910 15:58512611-58512633 GATCCAGCAGTCTTTTAGGAAGG + Intronic
1128747839 15:70126978-70127000 GACCCTGCAGAAATTTAGGGGGG - Intergenic
1130926665 15:88390716-88390738 GTCCCTGCAGCCCTATTGGTAGG + Intergenic
1132631792 16:921329-921351 GACCCAGCAGCCCCTCAAGAAGG - Intronic
1135770777 16:25216904-25216926 GCCTCTGCAGCCCTTTAAAAGGG + Exonic
1139009674 16:62616864-62616886 ACCCCTGCAGACCTTTAGAATGG + Intergenic
1140478208 16:75249466-75249488 CACCCTGCAGCCCTTTATCTGGG + Intronic
1140881650 16:79203964-79203986 CACCCAGCAGTCCTTTAGCACGG + Intronic
1143594003 17:7903262-7903284 GCCCCTGCAGGCCTTTAGCCGGG + Exonic
1143609902 17:8012210-8012232 GGCCCTGCGGCCCTCTGGGAGGG + Exonic
1145285191 17:21500359-21500381 GACCCTGGAGAGCTTCAGGATGG - Intergenic
1147323717 17:39660472-39660494 GATCCTGCAGCCCGAGAGGATGG + Exonic
1149512279 17:57253820-57253842 GAGCCTGGAGCTCTTCAGGAAGG + Intergenic
1150445353 17:65224083-65224105 GCCACAGCAGGCCTTTAGGAGGG + Intronic
1150985036 17:70186182-70186204 AACCCATCAGCCCTTCAGGAAGG - Intergenic
1151666714 17:75549497-75549519 GACCCAGCAGCCCCTGCGGAGGG + Intronic
1155241739 18:23870367-23870389 GACCCTTCAGCCCTCTTGGTGGG + Intronic
1157522434 18:48354714-48354736 GTCCCTGCAGCCAGTTAGGCAGG + Intronic
1159953849 18:74505951-74505973 CAGCCTGCAGCCCTGGAGGACGG + Exonic
1160532932 18:79576134-79576156 GACCCTGCAGCCCCTGCGGCGGG + Intergenic
1166455632 19:42937763-42937785 CACCCTGCACACCTCTAGGAAGG - Intronic
1167351488 19:48977799-48977821 TCTCCTGCAGCCCTTTATGAAGG - Intronic
925381633 2:3431375-3431397 GACCCTGCCGCCCTCTGGGCTGG - Intronic
930741542 2:54836983-54837005 GCCCTTGCAGCCCCTCAGGAAGG - Intronic
934056964 2:88259233-88259255 GACCCTGCAGCCGTTAATGGTGG + Intergenic
935187685 2:100748586-100748608 GACCCTCCAGCCCCTCAGGCTGG + Intergenic
935232357 2:101109918-101109940 GGCCCTGCAGCCCTTGAGTGGGG - Intronic
937255669 2:120553715-120553737 GAACCTACAGCCTGTTAGGAAGG + Intergenic
939994955 2:148911471-148911493 GGCCATGAAGCCCTTTAAGAAGG + Intronic
940928099 2:159391010-159391032 GACTCTGCTGCCCTTTTGTAAGG - Intronic
942708358 2:178802503-178802525 AAACCTGCAGACCATTAGGAAGG + Intronic
942768624 2:179487737-179487759 GGCACAGCAGCACTTTAGGAGGG - Intronic
946531772 2:220578153-220578175 CACCCTCCAGCCACTTAGGATGG - Intergenic
946595075 2:221297230-221297252 GACCCTGTAGGCCTTTGGGGAGG + Intergenic
1168829962 20:840485-840507 GAGACTGCAGCCCTGCAGGAAGG - Intronic
1171019450 20:21572057-21572079 GCCCCTGCAGCCATTTGGGGTGG - Intergenic
1174180080 20:48669044-48669066 CTCCCTGCAGCCCTCTGGGAAGG + Intronic
1175218304 20:57402974-57402996 GGCACTGCGGACCTTTAGGACGG + Intronic
1175904211 20:62371802-62371824 CACCCTGCCAGCCTTTAGGAGGG + Intergenic
1176029682 20:63005942-63005964 GACCCTGCAGACCAGGAGGAGGG - Exonic
1179471322 21:41612701-41612723 GCCCCTTCAGCACTTCAGGAAGG - Intergenic
1179977055 21:44874111-44874133 ACGCCCGCAGCCCTTTAGGATGG - Intergenic
1182583346 22:31328421-31328443 CTGCCTGCTGCCCTTTAGGATGG - Intronic
1183433937 22:37782511-37782533 TAGCCTCCAGCCCTTCAGGACGG - Intergenic
949243840 3:1902217-1902239 TAACCTGGAGCCCATTAGGAAGG + Intergenic
950253160 3:11483781-11483803 GACCCTGCAGCCAATCAGGATGG + Intronic
952307488 3:32159015-32159037 CACCCCGCAGCTCTCTAGGAAGG - Exonic
953243224 3:41167805-41167827 GTCCCTGCTGCCCTTTCTGAAGG - Intergenic
954449032 3:50561797-50561819 AACCCAGCAGCCCTTCTGGATGG + Intronic
955480728 3:59386711-59386733 GACACTGCAGACTTTTATGAGGG + Intergenic
961601880 3:128068560-128068582 GAGCCTGCAGTCTCTTAGGAAGG + Intronic
968019243 3:195369427-195369449 GTCCCTGAAGCCCTTGAGGGTGG - Intronic
968843977 4:3029546-3029568 GCCCCTGCAGCCCAGTAGGGAGG + Intronic
969075332 4:4573843-4573865 CACCCTGCAGCCTTCTTGGAGGG + Intergenic
969429851 4:7147760-7147782 GACCCTGCAGCTCTGCGGGACGG + Intergenic
969861785 4:10041563-10041585 GACCCTGCAGATATTTATGAAGG - Intronic
983088197 4:163473139-163473161 GGCCCTGCACCCCTTGAGCATGG - Exonic
986261198 5:6147942-6147964 GCCCCTTCAGCCCTTTTAGAAGG + Intergenic
989322077 5:40146808-40146830 GAAGCTGCAGCCCTTTAACAGGG - Intergenic
997360300 5:133290696-133290718 GCCCCTGGAGCCCTCTTGGATGG + Intronic
999397589 5:151239904-151239926 AATCCTGCAGCCCCTTTGGAGGG + Intronic
1000257429 5:159553286-159553308 GACCCTGCTGCCCTTTGGGTGGG + Intergenic
1001221539 5:169904642-169904664 GGCCCCGCAGTCCTTTAAGAAGG + Intronic
1003566800 6:7229410-7229432 GTCCCTGCAGCCCTTCCAGAAGG + Exonic
1005338270 6:24819020-24819042 GAGCTTGCAGGCCTTTATGATGG - Intronic
1006299261 6:33185188-33185210 GATCTTGCAGCCCCTTTGGAGGG + Intronic
1011162458 6:84406764-84406786 GCCCCTGCAAGCCTTTAAGATGG - Intergenic
1016052901 6:139549015-139549037 CTCCTTGCAGCCCTGTAGGATGG + Intergenic
1017318488 6:153060416-153060438 GACCCTCCTGGCCTTTGGGAAGG + Intronic
1018870205 6:167776907-167776929 GACTCTGCAGACCATGAGGACGG + Intergenic
1019567770 7:1693103-1693125 GGGCCTGCACCCCTTAAGGAGGG - Exonic
1019602934 7:1894348-1894370 GTCCCTGCAGACCTTCTGGAGGG - Intronic
1020105437 7:5420434-5420456 GAACCTGCACCCCGGTAGGAGGG - Intronic
1024080088 7:45848824-45848846 CACACTGCAGCCTTATAGGATGG - Intergenic
1026444793 7:70474825-70474847 GACCCTAAAGCACTTTATGACGG + Intronic
1032517402 7:132517382-132517404 GACCCTGAGGCCCTATAGGATGG + Intronic
1033389041 7:140908508-140908530 GACCCTCCAGCCATTTATCATGG - Intronic
1035451583 7:158980445-158980467 AACCCTGGACCCCTTTGGGATGG + Intergenic
1035646324 8:1223701-1223723 GCCCCTGCAGCCATTATGGAGGG + Intergenic
1038982606 8:32776337-32776359 CAACCTGCTGCCCTTTAGGTGGG - Intergenic
1040657405 8:49527587-49527609 GTCCCTGCAGTCCTTTACTAAGG - Intergenic
1040881794 8:52213387-52213409 GACCCTGCAGCCCTTTAGGAGGG - Intronic
1043557968 8:81455999-81456021 CACACTGAAGTCCTTTAGGAAGG + Intergenic
1046592721 8:116225411-116225433 GACCCTGCTGCCCTTTGGAAGGG - Intergenic
1049044776 8:140140860-140140882 GACCGTGCAGCCCATTGGGGTGG - Intronic
1058486708 9:105448523-105448545 CACTCTGCAGCGCTTTAGGCCGG + Intronic
1060112047 9:120913483-120913505 GGCCCTGCAGCACTTCATGAAGG - Exonic
1061057822 9:128233606-128233628 GTCCCTCCACGCCTTTAGGAAGG + Intronic
1061393463 9:130330482-130330504 GACCCTGCAGCTCTTGGGGCTGG + Intronic
1061877935 9:133554270-133554292 CACCCTGCAGCTCTGTGGGAAGG + Intronic
1062084234 9:134640812-134640834 AGCCCTGCAGCCCTTGGGGAAGG + Intergenic
1062308401 9:135922188-135922210 GGCCCTGCACCCCCTCAGGAGGG + Intergenic
1186539156 X:10382605-10382627 GGCCCTGTAGCCCTTGGGGATGG + Intergenic
1187202077 X:17144758-17144780 GACCCTGCTGCCATTTACCAGGG + Intronic
1195940347 X:110162462-110162484 GACTCTCCAGCCTCTTAGGATGG + Intronic
1197770811 X:130088076-130088098 TAACAAGCAGCCCTTTAGGAAGG + Intronic
1199860956 X:151800154-151800176 GATCCTGGAGCCCCTGAGGATGG - Intergenic