ID: 1040881795

View in Genome Browser
Species Human (GRCh38)
Location 8:52213388-52213410
Sequence TGACCCTGCAGCCCTTTAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 150}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040881795_1040881803 22 Left 1040881795 8:52213388-52213410 CCTCCTAAAGGGCTGCAGGGTCA 0: 1
1: 0
2: 1
3: 19
4: 150
Right 1040881803 8:52213433-52213455 CTGTGAGGTGGACTCTGAGGAGG No data
1040881795_1040881805 26 Left 1040881795 8:52213388-52213410 CCTCCTAAAGGGCTGCAGGGTCA 0: 1
1: 0
2: 1
3: 19
4: 150
Right 1040881805 8:52213437-52213459 GAGGTGGACTCTGAGGAGGGTGG No data
1040881795_1040881802 19 Left 1040881795 8:52213388-52213410 CCTCCTAAAGGGCTGCAGGGTCA 0: 1
1: 0
2: 1
3: 19
4: 150
Right 1040881802 8:52213430-52213452 CCTCTGTGAGGTGGACTCTGAGG No data
1040881795_1040881804 23 Left 1040881795 8:52213388-52213410 CCTCCTAAAGGGCTGCAGGGTCA 0: 1
1: 0
2: 1
3: 19
4: 150
Right 1040881804 8:52213434-52213456 TGTGAGGTGGACTCTGAGGAGGG No data
1040881795_1040881798 7 Left 1040881795 8:52213388-52213410 CCTCCTAAAGGGCTGCAGGGTCA 0: 1
1: 0
2: 1
3: 19
4: 150
Right 1040881798 8:52213418-52213440 GCCACAGCTTTTCCTCTGTGAGG No data
1040881795_1040881806 27 Left 1040881795 8:52213388-52213410 CCTCCTAAAGGGCTGCAGGGTCA 0: 1
1: 0
2: 1
3: 19
4: 150
Right 1040881806 8:52213438-52213460 AGGTGGACTCTGAGGAGGGTGGG No data
1040881795_1040881800 10 Left 1040881795 8:52213388-52213410 CCTCCTAAAGGGCTGCAGGGTCA 0: 1
1: 0
2: 1
3: 19
4: 150
Right 1040881800 8:52213421-52213443 ACAGCTTTTCCTCTGTGAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040881795 Original CRISPR TGACCCTGCAGCCCTTTAGG AGG (reversed) Intronic
901692081 1:10980277-10980299 TGAGCCTGCAGCCTTTGAGCTGG + Intronic
902808330 1:18874476-18874498 TGGGCCAGCAGCCCTTTGGGGGG - Exonic
907785090 1:57603595-57603617 TGATCCTGCAGTCCTTTAATTGG + Intronic
908839867 1:68268350-68268372 TGACCCTGAAGACCTTTTAGTGG + Intergenic
911497388 1:98648221-98648243 TGACCCTAAAGCCATTTTGGAGG - Intergenic
912584484 1:110750048-110750070 GGAACCTGGAGGCCTTTAGGAGG - Intergenic
912707632 1:111926700-111926722 TTCCCCTTCAGCACTTTAGGAGG + Intronic
913376292 1:118156449-118156471 TGGCCCTGGAGTCCTTTAGGAGG + Intronic
918041651 1:180917316-180917338 TGACCCTGCAGACCAATAGGAGG + Intronic
918445299 1:184611393-184611415 GGGCCCTGCAGCCCTGCAGGCGG + Intronic
918659575 1:187072907-187072929 TGAAGCTGCAGACCTTCAGGGGG + Intergenic
920215678 1:204360155-204360177 TGGCCCTGCTCCCCTTTGGGGGG - Intronic
923173061 1:231434871-231434893 GGACCCTGCATCCTTTTAGTGGG - Intergenic
923981809 1:239332886-239332908 TGACCATGAAGCCCTTCAGTAGG + Intergenic
924376568 1:243415549-243415571 TGACCCTCCCCCACTTTAGGGGG - Intronic
1063537639 10:6900729-6900751 TGACCCTGAAGCCCCAGAGGGGG + Intergenic
1064999406 10:21324045-21324067 TGACACTGCATGCCTTTGGGGGG - Intergenic
1066593245 10:37019271-37019293 TAGCTCTGCAGCCCTTCAGGTGG - Intergenic
1068051120 10:51950632-51950654 TGACCCTGAAGCCCCAGAGGGGG + Intronic
1077524571 11:3056757-3056779 TGCCCCAGCTGGCCTTTAGGGGG - Intronic
1077584795 11:3443018-3443040 AAATCCTGCAGCCCTTTTGGAGG + Intergenic
1079135862 11:17775722-17775744 GGACCCTGCAGCCCTGGACGCGG - Intronic
1079362536 11:19781242-19781264 AGGCCCTGCAGCGCTCTAGGAGG - Intronic
1080481191 11:32651839-32651861 TTACCCTGAACCCCTTTAGAAGG + Intronic
1081152724 11:39652117-39652139 TGACCCTGAAGCCCCAGAGGGGG + Intergenic
1083860247 11:65416554-65416576 TGTCCCTGCAGCCCGGCAGGAGG - Intergenic
1091686163 12:2564300-2564322 TCACACTGCAGCCCATTAGTGGG - Intronic
1093308225 12:17544987-17545009 TGACACTGCAGCCTTCTGGGTGG + Intergenic
1093758674 12:22881037-22881059 TGACCCTGAAGCCCCAGAGGGGG + Intergenic
1094856487 12:34405192-34405214 AGACACTGCAGCCCTTTAGTGGG - Intergenic
1101597119 12:106177505-106177527 TTACCCTGTAGCCCTTTCCGTGG + Intergenic
1102574049 12:113844690-113844712 TGACCCTGCAGGCCCTGCGGCGG - Exonic
1103174468 12:118850410-118850432 TACCTCTGCAGCCCTCTAGGAGG + Intergenic
1104428026 12:128693993-128694015 GGACCCTCCAGCCCTTTATCTGG - Exonic
1104901486 12:132191771-132191793 TGTCCCTGCAGCCCTCTCAGAGG + Intergenic
1108746966 13:53405793-53405815 TGACCCTGAAGCCCTAGAGGTGG - Intergenic
1117516667 14:56508774-56508796 TGTCCCTCCAGGCCTATAGGTGG - Intronic
1118776736 14:68978447-68978469 GGACCCTGCTGCCCCTTAGGCGG - Intronic
1121974852 14:98393638-98393660 TGAGCCTGCAGCTCTGCAGGAGG - Intergenic
1122657226 14:103270185-103270207 TCAGGCTGCAACCCTTTAGGAGG + Intergenic
1122888097 14:104719459-104719481 TCACCCTGCAGCCCCTCAGGTGG - Exonic
1123212690 14:106775685-106775707 TGACCCTGCAGCACTGGAAGAGG - Intergenic
1125371467 15:38983015-38983037 TGAAACTGCAGTCCATTAGGTGG + Intergenic
1125584070 15:40807879-40807901 TGGCCCTGCAGCCCTCGGGGAGG - Intronic
1127634957 15:60860180-60860202 TGACCATGCAAACCTTTAGATGG + Intronic
1127981222 15:64036844-64036866 TGCCTCTGCAGCCTTCTAGGAGG - Intronic
1128747840 15:70126979-70127001 TGACCCTGCAGAAATTTAGGGGG - Intergenic
1129116265 15:73367147-73367169 TGACTCTGCAGCCTTGAAGGGGG + Intronic
1132792577 16:1700324-1700346 TGGGCCTGCAGCCCTTGAGGGGG - Exonic
1133353194 16:5116567-5116589 AAAGCCTGCAGCCCTTTTGGAGG + Intergenic
1138579833 16:57933488-57933510 TGTCCCTGCAGTCCCTGAGGTGG - Intronic
1138639339 16:58370809-58370831 TGATCCTACACCCCTTTCGGTGG - Intronic
1140478207 16:75249465-75249487 CCACCCTGCAGCCCTTTATCTGG + Intronic
1143594002 17:7903261-7903283 TGCCCCTGCAGGCCTTTAGCCGG + Exonic
1146133453 17:30297744-30297766 TGACCCTGAAGCCCCAGAGGGGG - Intergenic
1149320208 17:55474275-55474297 TGTCGAGGCAGCCCTTTAGGTGG + Intergenic
1150737237 17:67751321-67751343 TGACCCTGAAGCCCCAGAGGGGG - Intergenic
1151666713 17:75549496-75549518 TGACCCAGCAGCCCCTGCGGAGG + Intronic
1151822360 17:76503331-76503353 TAACCCTGCAGGGGTTTAGGGGG + Intergenic
1152841388 17:82570967-82570989 AGACCCTGCCGCCCATGAGGAGG - Intronic
1154510374 18:15094042-15094064 TGAACCTGCAGCCCTTTGCATGG + Intergenic
1155241738 18:23870366-23870388 GGACCCTTCAGCCCTCTTGGTGG + Intronic
1158518663 18:58151861-58151883 TGACCCTGAAGCCATTGGGGTGG - Intronic
1160532931 18:79576133-79576155 GGACCCTGCAGCCCCTGCGGCGG + Intergenic
1160973110 19:1778713-1778735 TGGCCCAGCAGCACTTTGGGAGG + Exonic
1160990867 19:1859815-1859837 TGACCCTGCAGCCCCCTGGGGGG + Intronic
1162916462 19:13876998-13877020 AGGCCATACAGCCCTTTAGGAGG + Intronic
1166425125 19:42670631-42670653 TCACCCTCCAGACCTTTAGGCGG - Intronic
1167098832 19:47391614-47391636 TGATCCTGCATCCCTCCAGGGGG - Intergenic
928318716 2:30266492-30266514 TGACACTGCAGCCCTCTAGACGG - Intronic
929647853 2:43647755-43647777 TGGGCCTGCATCCATTTAGGGGG - Intronic
934641314 2:96028547-96028569 TGTCCCTGCAGCCCAACAGGAGG + Intronic
935232358 2:101109919-101109941 CGGCCCTGCAGCCCTTGAGTGGG - Intronic
936397823 2:112142400-112142422 TGCCCCTGGAGCCCTATAGTGGG - Intronic
936935803 2:117837029-117837051 TGAGCGTTCAGCCCTTTAGATGG - Intergenic
938300409 2:130207332-130207354 TGAGCCTGAAGCCCTCGAGGTGG + Intergenic
938456319 2:131467145-131467167 TGAGCCTGAAGCCCTCGAGGTGG - Intronic
942381111 2:175391939-175391961 TCACCCTGAAGCCCTTAAGTAGG + Intergenic
943574316 2:189613290-189613312 TGAGTCTGCAGTCCTTTAAGAGG - Intergenic
943878549 2:193107370-193107392 TGACTCTGCAGCCCTGTAATTGG + Intergenic
946440307 2:219689428-219689450 TGACCACGCAGCCTTCTAGGTGG + Intergenic
948018707 2:234712503-234712525 TGACCCTGGAGCCCTTGCTGTGG - Intergenic
1171408988 20:24933571-24933593 TGTCCCTGCAGCCCTGCAGCTGG + Intergenic
1171935578 20:31272252-31272274 TGATGCTGCAGCCCTTTGAGTGG - Intergenic
1173670696 20:44796677-44796699 TGACCCTGGAGCCCTGGAGAAGG + Intronic
1173767814 20:45630057-45630079 TGGCCCTCCAGCCCCTTAGCTGG + Intronic
1176045905 20:63092465-63092487 TGTCCCTGCAGCCCTTGAAATGG + Intergenic
1176787493 21:13275360-13275382 TGAACCTGCAGCCCTTTGCATGG - Intergenic
1183578841 22:38710502-38710524 TGACCATGCCTTCCTTTAGGTGG - Intronic
1183650603 22:39151541-39151563 CCTCCCTGCAGCCCTTTGGGAGG - Intronic
1185109974 22:48895390-48895412 TGACCCCACAGCCCTTCAGTTGG + Intergenic
950418215 3:12881032-12881054 TAAAACTGCAGCACTTTAGGAGG - Intergenic
951382070 3:21995992-21996014 TGATCCTGCAGCCCTTTGGGTGG + Intronic
957984235 3:87551795-87551817 TCACCCTGCAGCCTCTGAGGAGG - Intergenic
960844726 3:121995081-121995103 TGTCACTCCAGCCCCTTAGGTGG + Intronic
961130451 3:124461666-124461688 TGGCCCTGTAACCCTTTAGCAGG - Intronic
961343604 3:126246687-126246709 TGACCCTGAGGCCATTGAGGTGG + Intergenic
962812419 3:138971151-138971173 TGTCCCTGCAGCCTTTTCTGAGG + Intergenic
963253559 3:143122050-143122072 TGGCCCTGCAGCCAGTCAGGGGG - Exonic
966499070 3:180617492-180617514 TGACCCTGAAGACCTTCAAGTGG + Intronic
966787555 3:183635420-183635442 TGAGTCAGCAGCCCTTTGGGTGG + Intergenic
967782145 3:193451284-193451306 TGACCCTGCAGCCATTTTCTTGG - Intronic
967835132 3:193956074-193956096 TGACACTGCAGTCCTCTGGGTGG + Intergenic
969075331 4:4573842-4573864 TCACCCTGCAGCCTTCTTGGAGG + Intergenic
969301891 4:6301868-6301890 TGACCCTGTGGCCCTCCAGGTGG - Exonic
969781256 4:9406051-9406073 TGACTCTGCAGGCCTCTGGGTGG - Intergenic
975082411 4:70296932-70296954 TGACGATGAAGCCCTTTTGGGGG - Intergenic
976919578 4:90422335-90422357 TGATCCTCCAGCACTTTGGGAGG + Intronic
984744083 4:183196653-183196675 TGGCACTGGAGGCCTTTAGGAGG + Intronic
989322078 5:40146809-40146831 TGAAGCTGCAGCCCTTTAACAGG - Intergenic
993020301 5:82584128-82584150 TGAGGCTGCAGACCTTTGGGTGG + Intergenic
993450012 5:88061735-88061757 TGCCACTGCAGCCCTCCAGGTGG - Intergenic
993991270 5:94660981-94661003 TGACACTGCAGCTCTCTGGGTGG + Intronic
994428221 5:99622236-99622258 TGACTCTGCAACCCTTTGGGTGG - Intergenic
997111326 5:131078104-131078126 TGTCCCTGAAGCCCTTTACCTGG - Intergenic
998157094 5:139793244-139793266 TGACCCTGCTGTCTTTCAGGAGG + Intergenic
999325752 5:150642393-150642415 TGGCCCTGCAGAAGTTTAGGTGG + Intronic
999397588 5:151239903-151239925 TAATCCTGCAGCCCCTTTGGAGG + Intronic
1000257428 5:159553285-159553307 AGACCCTGCTGCCCTTTGGGTGG + Intergenic
1001065263 5:168530430-168530452 TGACCCTGGAGCCCTATGAGCGG + Exonic
1005475345 6:26202468-26202490 TCACCCTCCAGACCTTCAGGCGG - Intergenic
1005592972 6:27348060-27348082 TGACACTGAAGCCCTCTGGGTGG - Intergenic
1006992750 6:38229413-38229435 TGACCCTACAGCCCCTTTGATGG + Intronic
1008248123 6:49204007-49204029 TGACCCTGAAGCCCTAGAGGGGG - Intergenic
1009033761 6:58092094-58092116 TACCCCTGCAGCCCGTTGGGTGG - Intergenic
1009576276 6:65465723-65465745 TGTAACTGCAGCACTTTAGGTGG + Intronic
1011295886 6:85826490-85826512 TGACACTTCAGCCCTCTGGGTGG - Intergenic
1011492470 6:87906614-87906636 TGTGCCTGCAGCCCCATAGGGGG - Intergenic
1013227767 6:108132883-108132905 AGACCCAGTAGCCCTTTAGTGGG - Intronic
1015472496 6:133621448-133621470 TGTCATTGCAGCACTTTAGGAGG - Intergenic
1016351995 6:143178227-143178249 TGACTCTGCATCCCTCTGGGTGG + Intronic
1016936984 6:149454907-149454929 TGCCCCTGCAGCCGTGGAGGTGG - Intronic
1017220692 6:151962263-151962285 TTATCCTGAGGCCCTTTAGGAGG + Intronic
1019221989 6:170480217-170480239 TGTCACTGCTGCCCTCTAGGAGG - Intergenic
1020009461 7:4800287-4800309 AGACTCTGCAGCCCTTGCGGAGG - Exonic
1020764579 7:12303905-12303927 TGAGCCAGCACCCCTTTGGGAGG + Intergenic
1027628624 7:80575212-80575234 TGCCACTGCATCCCTGTAGGTGG + Intronic
1028522453 7:91747297-91747319 TGACACTGCAGCCCTTTGTTTGG - Intronic
1029705704 7:102274691-102274713 TGACCCTTCAGCCCTGCCGGTGG + Intronic
1032113633 7:129098503-129098525 GGACCCTACCACCCTTTAGGGGG - Intergenic
1032349604 7:131148293-131148315 TTACCCTGCAGCCTTTTGGCTGG + Intronic
1032887394 7:136155943-136155965 TGCCCATGCAGCTCTTGAGGTGG + Intergenic
1035189219 7:157151130-157151152 TGCTACTGCTGCCCTTTAGGGGG - Intronic
1036913847 8:12785597-12785619 TGATGCTGCAGCCCTCTAAGTGG + Intergenic
1037927496 8:22855515-22855537 TGGCCCTGCAGGCCTTTTGGAGG + Intronic
1038215930 8:25561801-25561823 TGACCCTGAAGCCCCAGAGGGGG + Intergenic
1038547211 8:28434913-28434935 TGACCCTGAAGCCCCAGAGGGGG + Intronic
1038982607 8:32776338-32776360 TCAACCTGCTGCCCTTTAGGTGG - Intergenic
1039639808 8:39206748-39206770 TGACACTGCAGCCCTCTGGGTGG + Intronic
1039993173 8:42507232-42507254 TGAGCATGCAGCCTTTTTGGAGG - Intronic
1040881795 8:52213388-52213410 TGACCCTGCAGCCCTTTAGGAGG - Intronic
1041389587 8:57336853-57336875 TCCCCATGCAGCCCTTCAGGTGG - Intergenic
1044817223 8:96125514-96125536 TGGTCTTGCTGCCCTTTAGGTGG - Intergenic
1045272145 8:100671005-100671027 TGACCCTGAAGCCCTAGAGTGGG - Intergenic
1046121177 8:109848826-109848848 TGATGCTGCAGCCCTCTGGGTGG + Intergenic
1046592722 8:116225412-116225434 GGACCCTGCTGCCCTTTGGAAGG - Intergenic
1047283729 8:123468002-123468024 TGAACCTCCAGCACTTTGGGAGG - Intergenic
1052678868 9:31662597-31662619 TGAAGCTGCAGCCCTGTAGCAGG - Intergenic
1057314295 9:93958794-93958816 AGACCCTACAGCCCCTTTGGAGG + Intergenic
1059281185 9:113135691-113135713 TCACCATGCAGTCCTTTAGCTGG + Intergenic
1061697479 9:132387679-132387701 TCACCCTTCAACACTTTAGGGGG + Intronic
1186520145 X:10198960-10198982 GGACCCTGCAGCCCTGATGGTGG + Intronic
1187326379 X:18294663-18294685 TGCCACTGCAGCCCTCTGGGTGG - Intronic
1190116078 X:47627029-47627051 TGACCATGCAGCCCTTCATTTGG - Intronic
1190176770 X:48157121-48157143 TGACATTGCAGCACTTTGGGAGG - Intergenic
1190797428 X:53758640-53758662 TGACCCTTCAGGGCTTGAGGTGG - Intergenic
1190917711 X:54822499-54822521 TGACCCTTCAGGGCTTGAGGTGG + Intergenic
1194193140 X:90861166-90861188 TGTCACTGCAGCTCTCTAGGTGG + Intergenic
1199884378 X:152005031-152005053 TGCCACTGCAGCCCTTCAGGTGG - Intergenic
1200539754 Y:4443616-4443638 TGTCACTGCAGCTCTCTAGGTGG + Intergenic
1201550605 Y:15213174-15213196 TCACCCTGCAGTCTTTTACGTGG - Intergenic