ID: 1040881796

View in Genome Browser
Species Human (GRCh38)
Location 8:52213391-52213413
Sequence CCGTGACCCTGCAGCCCTTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 111}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040881796_1040881800 7 Left 1040881796 8:52213391-52213413 CCTAAAGGGCTGCAGGGTCACGG 0: 1
1: 0
2: 2
3: 14
4: 111
Right 1040881800 8:52213421-52213443 ACAGCTTTTCCTCTGTGAGGTGG No data
1040881796_1040881808 29 Left 1040881796 8:52213391-52213413 CCTAAAGGGCTGCAGGGTCACGG 0: 1
1: 0
2: 2
3: 14
4: 111
Right 1040881808 8:52213443-52213465 GACTCTGAGGAGGGTGGGTTGGG No data
1040881796_1040881806 24 Left 1040881796 8:52213391-52213413 CCTAAAGGGCTGCAGGGTCACGG 0: 1
1: 0
2: 2
3: 14
4: 111
Right 1040881806 8:52213438-52213460 AGGTGGACTCTGAGGAGGGTGGG No data
1040881796_1040881804 20 Left 1040881796 8:52213391-52213413 CCTAAAGGGCTGCAGGGTCACGG 0: 1
1: 0
2: 2
3: 14
4: 111
Right 1040881804 8:52213434-52213456 TGTGAGGTGGACTCTGAGGAGGG No data
1040881796_1040881809 30 Left 1040881796 8:52213391-52213413 CCTAAAGGGCTGCAGGGTCACGG 0: 1
1: 0
2: 2
3: 14
4: 111
Right 1040881809 8:52213444-52213466 ACTCTGAGGAGGGTGGGTTGGGG No data
1040881796_1040881798 4 Left 1040881796 8:52213391-52213413 CCTAAAGGGCTGCAGGGTCACGG 0: 1
1: 0
2: 2
3: 14
4: 111
Right 1040881798 8:52213418-52213440 GCCACAGCTTTTCCTCTGTGAGG No data
1040881796_1040881802 16 Left 1040881796 8:52213391-52213413 CCTAAAGGGCTGCAGGGTCACGG 0: 1
1: 0
2: 2
3: 14
4: 111
Right 1040881802 8:52213430-52213452 CCTCTGTGAGGTGGACTCTGAGG No data
1040881796_1040881807 28 Left 1040881796 8:52213391-52213413 CCTAAAGGGCTGCAGGGTCACGG 0: 1
1: 0
2: 2
3: 14
4: 111
Right 1040881807 8:52213442-52213464 GGACTCTGAGGAGGGTGGGTTGG No data
1040881796_1040881805 23 Left 1040881796 8:52213391-52213413 CCTAAAGGGCTGCAGGGTCACGG 0: 1
1: 0
2: 2
3: 14
4: 111
Right 1040881805 8:52213437-52213459 GAGGTGGACTCTGAGGAGGGTGG No data
1040881796_1040881803 19 Left 1040881796 8:52213391-52213413 CCTAAAGGGCTGCAGGGTCACGG 0: 1
1: 0
2: 2
3: 14
4: 111
Right 1040881803 8:52213433-52213455 CTGTGAGGTGGACTCTGAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040881796 Original CRISPR CCGTGACCCTGCAGCCCTTT AGG (reversed) Intronic
900631892 1:3640883-3640905 CTGTGGCCCTGCATCCCTGTGGG + Intronic
900813459 1:4825759-4825781 TGGTCACCCTGCAGCCCTTGGGG + Intergenic
901148650 1:7085747-7085769 CCGTGACCCTCCAGCCCTGCTGG + Intronic
901432436 1:9225276-9225298 CTGTGACCCTGCAGCCACTTGGG + Intergenic
901668320 1:10838862-10838884 CCCTGCCCCTGCACCCCTTCAGG + Intergenic
902057694 1:13615907-13615929 GCGTAACCCTTCAGCTCTTTAGG - Exonic
902629015 1:17693832-17693854 CCCTGATCCTGCTGCCCTCTGGG - Intronic
903377108 1:22873720-22873742 CAGAGACCTTGCAGCCATTTTGG - Intronic
905106230 1:35565213-35565235 CCGTTACCTTGCAGCTCTTCAGG + Exonic
913376291 1:118156446-118156468 CCATGGCCCTGGAGTCCTTTAGG + Intronic
918041650 1:180917313-180917335 CCATGACCCTGCAGACCAATAGG + Intronic
920215681 1:204360158-204360180 CGGTGGCCCTGCTCCCCTTTGGG - Intronic
922851389 1:228736090-228736112 CCGGGGCCCTGCAGCCCCCTTGG - Intronic
1068594030 10:58883034-58883056 CCGTGACACTACAGCCCTCTGGG + Intergenic
1070279111 10:75036050-75036072 CTATGACCCTGGATCCCTTTTGG + Intergenic
1071602955 10:86967858-86967880 CAGTGCCCCTGCAGCTGTTTGGG + Intronic
1072625298 10:97107498-97107520 CCTTGACACTGGAGCCCTTTTGG + Intronic
1076269898 10:129143066-129143088 CCGGGAACCTGCAACCCTTGGGG + Intergenic
1077140043 11:1020275-1020297 CCGGTACCCTGCAGCCCTGATGG - Intronic
1078453932 11:11460559-11460581 CCCTGACCTTGAAGCCCTTTTGG + Intronic
1079366744 11:19816385-19816407 CCATGGCCCTCCAGCCCGTTGGG - Intronic
1081152721 11:39652114-39652136 CCGTGACCCTGAAGCCCCAGAGG + Intergenic
1081756614 11:45549313-45549335 CCCTGACCCTGCATCCCACTGGG - Intergenic
1084208776 11:67611361-67611383 CCCTGACCATGCATCCCTTTGGG + Intronic
1084368135 11:68717059-68717081 CCGTGTTCCTGCAGCACTATGGG - Intronic
1088951024 11:114569972-114569994 TTGTGACCCTGCAGCCATGTAGG - Intergenic
1089192009 11:116660195-116660217 CCATGTCCCTGCAGCCTTTCTGG - Intergenic
1089541221 11:119190003-119190025 CCTTGAGCCTGAGGCCCTTTTGG - Exonic
1090828551 11:130405026-130405048 CTGCGACGCTGCGGCCCTTTAGG + Exonic
1092226728 12:6752875-6752897 CCCAGACCCTGCAGCCCCGTGGG + Intronic
1096972936 12:55682018-55682040 AGGTGACCCTGCAGCCCGGTGGG - Exonic
1099209771 12:79770017-79770039 CAGTGTCCCTGGAGTCCTTTAGG + Intergenic
1101892010 12:108725569-108725591 CCGTGAGGGTGCAGGCCTTTAGG - Intronic
1104002187 12:124866989-124867011 CCATGGCCTTGCAGCCCTCTTGG - Intronic
1105891347 13:24684675-24684697 CCGTGGCCCTGCTGCCATTCTGG - Intronic
1106463688 13:29994385-29994407 CCCAGACCCTGCAGCGCTGTGGG - Intergenic
1108746967 13:53405796-53405818 CTGTGACCCTGAAGCCCTAGAGG - Intergenic
1111633502 13:90873876-90873898 CCTTTTCCCTGCAGCCCTCTTGG + Intergenic
1111922457 13:94426843-94426865 CCCTGAGCCTGGATCCCTTTGGG + Intergenic
1112785571 13:102947777-102947799 CCAGGACCCTCCAGCCCTATAGG - Intergenic
1117980048 14:61333955-61333977 CCGTGACCCAGCAGATTTTTTGG + Intronic
1118776737 14:68978450-68978472 CCGGGACCCTGCTGCCCCTTAGG - Intronic
1118817438 14:69323356-69323378 CCGGCTCCCTCCAGCCCTTTCGG - Intronic
1120765705 14:88324990-88325012 CTCTGACTCTTCAGCCCTTTAGG + Intronic
1123125835 14:105945364-105945386 CCTGGACCCAGCAGCCCTCTGGG - Intergenic
1124475353 15:30028421-30028443 CCCTGGCCCTGCAGCCCACTGGG - Intergenic
1125584072 15:40807882-40807904 CCCTGGCCCTGCAGCCCTCGGGG - Intronic
1128648908 15:69396498-69396520 TCCTTACCCTGCAGCCCTGTGGG + Intronic
1129828570 15:78651895-78651917 CCCTGTCCCTGCAGCCCTTTTGG - Intronic
1130897311 15:88181494-88181516 CGGTGTCCCTGCAGCTCTTAGGG - Intronic
1130926664 15:88390712-88390734 CTTTGTCCCTGCAGCCCTATTGG + Intergenic
1131589419 15:93731966-93731988 TCATGACACTGTAGCCCTTTGGG + Intergenic
1132185243 15:99797784-99797806 CAGTCACCCTGCTGTCCTTTTGG - Intergenic
1132431745 15:101766771-101766793 CAGTCACCCTGCTGTCCTTTTGG + Intergenic
1133212624 16:4271956-4271978 ACGTGACTCTGCAGCCCTCTTGG - Intronic
1134112116 16:11522144-11522166 CCTTGAACCTGCAGCCCTCTGGG + Intronic
1141399328 16:83733357-83733379 CAGGGACCCTGCAGCCCTCCCGG + Intronic
1141679296 16:85535123-85535145 CACTGAGCCTGGAGCCCTTTGGG - Intergenic
1143658504 17:8311181-8311203 CCCTGACCCTGCAGCCTTCTTGG + Intronic
1145081693 17:19899671-19899693 CCGTGGCTCTGCAGAGCTTTGGG - Intergenic
1145236171 17:21209828-21209850 GCGTGTCCCTGCAGTCCATTAGG - Intronic
1146552243 17:33791429-33791451 CCATGACCCTGGACCCCATTGGG + Intronic
1148344488 17:46894502-46894524 CCCCGACCCTACAGCCCTTGAGG + Intergenic
1150275286 17:63894159-63894181 CCGTGTCCCTGCAGTCCTGATGG + Intergenic
1150277417 17:63908847-63908869 CCGTGTCCCTGCAGTCCTGATGG + Intergenic
1150620766 17:66806418-66806440 CCCTGTCCCTGCAGCCCTGCAGG + Exonic
1151330521 17:73404199-73404221 CCATGACCCTGCTGCCATCTTGG - Intronic
1156189793 18:34705146-34705168 CCCTGACCCTTCAGCTCTTTTGG + Intronic
1158071804 18:53479011-53479033 CCATCACCCTTCAGCCCTTGTGG + Intronic
1160990864 19:1859812-1859834 GGGTGACCCTGCAGCCCCCTGGG + Intronic
1163726549 19:18926296-18926318 GCCTGACCCTGCCGCCCTGTGGG - Exonic
1168553718 19:57320830-57320852 CTGAGACCCTGCAGCCCTAGCGG - Exonic
925381634 2:3431379-3431401 CGGCGACCCTGCCGCCCTCTGGG - Intronic
933937170 2:87216256-87216278 CCGAGACCCTGGAGCTCTCTGGG + Intergenic
937979407 2:127605873-127605895 CTGTGACCCTGCAGGCCTGGTGG + Exonic
944465909 2:199999335-199999357 CCGTAACTCTACAGCACTTTAGG - Intronic
946093959 2:217256032-217256054 GGGAGACTCTGCAGCCCTTTGGG - Intergenic
947811049 2:233004211-233004233 CCCTGACCCTGCAGCCCTGCAGG + Intronic
1180176740 21:46094205-46094227 ACGTGACCCAGCAGCCCCTGTGG - Intergenic
1181515047 22:23405436-23405458 CCGGGACACTACAGACCTTTTGG + Intergenic
1183562207 22:38584073-38584095 CAGTGTGCCAGCAGCCCTTTGGG - Intronic
1183650605 22:39151544-39151566 CCTCCTCCCTGCAGCCCTTTGGG - Intronic
1184189506 22:42885529-42885551 CCGAGACACTGCAGGCCTATCGG + Intronic
1184727920 22:46357134-46357156 CCGGGCCCCTGCAGGCTTTTCGG - Exonic
1184783817 22:46662280-46662302 CCCTGAGCCTGCAGCCCCCTGGG + Intronic
1184904070 22:47467644-47467666 CAGCAAGCCTGCAGCCCTTTGGG + Intronic
950053692 3:10009844-10009866 CCAAGAACCTGGAGCCCTTTCGG + Intronic
951382069 3:21995989-21996011 TCGTGATCCTGCAGCCCTTTGGG + Intronic
952846440 3:37691448-37691470 CTGTGAGCCTGCTGCCCTGTGGG - Intronic
954596525 3:51830004-51830026 GCGTGGTGCTGCAGCCCTTTGGG - Intronic
955463860 3:59215660-59215682 GAGTGACCCTGGAGACCTTTGGG - Intergenic
960223979 3:115147961-115147983 CCCTCACCCCGCAGCCCTCTCGG - Intergenic
961343603 3:126246684-126246706 CCGTGACCCTGAGGCCATTGAGG + Intergenic
968843974 4:3029542-3029564 CCCTGCCCCTGCAGCCCAGTAGG + Intronic
970454668 4:16210809-16210831 CCCTGACCCTACAACCCCTTGGG - Intronic
978044286 4:104107157-104107179 CTGTGGCCCTGCAGCCCCCTTGG - Intergenic
982296525 4:153834752-153834774 CATTGACCCTGCAGCCATCTAGG - Intergenic
986286584 5:6363425-6363447 CGGTGACCCTGGAGCTCCTTGGG + Intergenic
986331303 5:6717804-6717826 CCCTGACCCAGCAGGGCTTTGGG + Intronic
991309237 5:65216970-65216992 CCATGACCCTTTAGTCCTTTTGG - Intronic
994428222 5:99622239-99622261 CTGTGACTCTGCAACCCTTTGGG - Intergenic
1000257427 5:159553282-159553304 GTGAGACCCTGCTGCCCTTTGGG + Intergenic
1002921469 6:1576185-1576207 CCATGACCCTGCAGCACAATGGG - Intergenic
1003581186 6:7342296-7342318 CCGTGAGCATGAAGCCCTTCTGG - Intronic
1003619276 6:7683524-7683546 CCTGGCCCCTGCAGCCCTATGGG - Intergenic
1006922011 6:37633438-37633460 CCGTGACCCTCCCGGTCTTTGGG + Exonic
1006960760 6:37927668-37927690 CCCTGACCCTGCAGGCATATAGG - Intronic
1008248126 6:49204010-49204032 CTGTGACCCTGAAGCCCTAGAGG - Intergenic
1013368185 6:109450077-109450099 CTCTGACACTGCAGCCCTTCTGG - Exonic
1013507320 6:110814254-110814276 CCTTTACCTTGCAGCCCCTTGGG - Intronic
1020280897 7:6649528-6649550 CCTTGTCCCTGGAGCCCTGTTGG + Intronic
1023092506 7:36630156-36630178 GCGTGGCCCTGCTGCCATTTTGG + Intronic
1029705702 7:102274688-102274710 CCCTGACCCTTCAGCCCTGCCGG + Intronic
1029949810 7:104571722-104571744 CCCTGCCCTTGCAGCCCTGTAGG + Intronic
1034443966 7:151102243-151102265 CGGTGAGCCTGCAGCCCAGTAGG + Intronic
1037927495 8:22855512-22855534 CTCTGGCCCTGCAGGCCTTTTGG + Intronic
1039639807 8:39206745-39206767 TTGTGACACTGCAGCCCTCTGGG + Intronic
1040881796 8:52213391-52213413 CCGTGACCCTGCAGCCCTTTAGG - Intronic
1042871654 8:73405401-73405423 CCGGGACCAGGCAGCCCTTTGGG + Intergenic
1049340828 8:142111821-142111843 CCCTGATGCTGCAGCACTTTTGG + Intergenic
1049543877 8:143220686-143220708 CCTTGACCCTGCAGCGCCTCAGG + Intergenic
1051709196 9:19912742-19912764 CCATCAACCTGCATCCCTTTGGG + Intergenic
1060520159 9:124289865-124289887 CCAAGACCATGCAGCCCTATGGG + Intronic
1061393461 9:130330478-130330500 ACCTGACCCTGCAGCTCTTGGGG + Intronic
1061435838 9:130561309-130561331 CCTTGAGCCTGGAGTCCTTTGGG + Intergenic
1190176771 X:48157124-48157146 CTGTGACATTGCAGCACTTTGGG - Intergenic
1191027170 X:55926203-55926225 CTGTGACACTGATGCCCTTTAGG + Intergenic
1200226026 X:154418249-154418271 CCCTGACCCAGCAGCCCACTTGG - Intronic