ID: 1040881798

View in Genome Browser
Species Human (GRCh38)
Location 8:52213418-52213440
Sequence GCCACAGCTTTTCCTCTGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040881795_1040881798 7 Left 1040881795 8:52213388-52213410 CCTCCTAAAGGGCTGCAGGGTCA 0: 1
1: 0
2: 1
3: 19
4: 150
Right 1040881798 8:52213418-52213440 GCCACAGCTTTTCCTCTGTGAGG No data
1040881796_1040881798 4 Left 1040881796 8:52213391-52213413 CCTAAAGGGCTGCAGGGTCACGG 0: 1
1: 0
2: 2
3: 14
4: 111
Right 1040881798 8:52213418-52213440 GCCACAGCTTTTCCTCTGTGAGG No data
1040881794_1040881798 8 Left 1040881794 8:52213387-52213409 CCCTCCTAAAGGGCTGCAGGGTC 0: 1
1: 0
2: 1
3: 9
4: 133
Right 1040881798 8:52213418-52213440 GCCACAGCTTTTCCTCTGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040881798 Original CRISPR GCCACAGCTTTTCCTCTGTG AGG Intronic
No off target data available for this crispr