ID: 1040882482

View in Genome Browser
Species Human (GRCh38)
Location 8:52221785-52221807
Sequence CTGTAGTTCCTGGGGAAAAA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 255
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 232}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040882478_1040882482 17 Left 1040882478 8:52221745-52221767 CCAGACATTAAATAGATGCTTCT 0: 1
1: 0
2: 0
3: 13
4: 178
Right 1040882482 8:52221785-52221807 CTGTAGTTCCTGGGGAAAAATGG 0: 1
1: 0
2: 2
3: 20
4: 232

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040882482 Original CRISPR CTGTAGTTCCTGGGGAAAAA TGG Exonic
900467617 1:2833424-2833446 CTGTGATTGCAGGGGAAAAATGG - Intergenic
900974577 1:6009048-6009070 CTGCAGCTCCTGGGGGAGAAGGG - Intronic
902721157 1:18305082-18305104 CTGAAGTTCCTGGGAAAGTAAGG + Intronic
902860087 1:19239040-19239062 GTCTCGTTCCTGGGGAGAAATGG + Intronic
903149281 1:21394212-21394234 CTGTGACTCCTTGGGAAAAATGG + Intergenic
904762566 1:32816663-32816685 CTGTAGTTCTTGGTAACAAACGG + Intronic
906271856 1:44485552-44485574 ATGCCTTTCCTGGGGAAAAACGG - Intronic
906490720 1:46266472-46266494 ATGTAGTTCTTGGAGAAAGAGGG + Intronic
907987745 1:59549205-59549227 CTGGAGTTCCTGGAGAGGAAGGG - Intronic
909924662 1:81425623-81425645 CTGTAGTGCCTGGTGGAGAATGG - Intronic
910026234 1:82657733-82657755 TTTTAGTTCTTGGGGATAAAAGG + Intergenic
911293189 1:96082381-96082403 CTTTAGATTCTGGGGAAAACTGG - Intergenic
911407120 1:97455916-97455938 CTGAAGTTCCTGATGACAAAAGG - Intronic
916420360 1:164632348-164632370 CTTTAATTCCTTGGGAAAATGGG - Intronic
917078534 1:171232802-171232824 CTGTATGTTCTGGGGAAAATGGG - Intergenic
917327858 1:173851537-173851559 CTGCTGTTCTTGAGGAAAAAGGG - Intronic
917465921 1:175276059-175276081 CTATAGTGCATGGGGAAAGAGGG - Intergenic
917613493 1:176714117-176714139 CTGTAGTGCCTTGACAAAAAGGG + Intronic
918013649 1:180611213-180611235 CTGCTGTTGCTGGGGAAGAAAGG - Intergenic
918203305 1:182287482-182287504 CTGGATTTCCTGTGGAGAAATGG - Intergenic
918203472 1:182288744-182288766 CTGGATTTCCTGTGGAGAAATGG + Intergenic
918261621 1:182801430-182801452 GTGAAGTTCATGGAGAAAAAAGG + Intronic
918306320 1:183250127-183250149 CTGAATTTCCTGGGGAAACATGG - Exonic
918313751 1:183305558-183305580 CTGTTTTTCCTGGGTAAAACAGG + Intronic
919390794 1:196982946-196982968 CTGTAGGAACTTGGGAAAAAGGG - Exonic
920741097 1:208582083-208582105 CTGTGGTTAATGGGGTAAAAAGG - Intergenic
920943011 1:210501636-210501658 CAGCTGCTCCTGGGGAAAAATGG + Intronic
921546146 1:216477270-216477292 CTGTGGTACCTGAGGAAGAATGG - Intergenic
921558040 1:216622984-216623006 TTGTACTTCCAGAGGAAAAAAGG - Intronic
923648902 1:235853525-235853547 CAGTAGTTCTGGGGGAAGAATGG + Intronic
924481219 1:244436054-244436076 CAGTGTTTCCAGGGGAAAAAAGG - Intronic
1063417494 10:5886069-5886091 TTGCATTTCCTGGGCAAAAATGG - Intronic
1063500988 10:6554300-6554322 CAGTAGTTTCAGGAGAAAAATGG + Intronic
1065600355 10:27361719-27361741 CTGTAGTTACTAAGAAAAAATGG - Intergenic
1066200395 10:33138346-33138368 CAGTAGTTTCTGGGGAGACAAGG + Intergenic
1068041130 10:51825650-51825672 TTGTATTTCCAGGGGAAATATGG - Intronic
1069261841 10:66408009-66408031 CTGAAGTTCCTGGTGTAAAATGG + Intronic
1071996954 10:91158949-91158971 GTGAAGTTCCAGGGGAGAAAGGG - Intergenic
1072086150 10:92081246-92081268 CTGTAGTTTCCTGGGAAGAAAGG - Intronic
1072292950 10:93982345-93982367 CTGTAGTATCAGGGGAGAAAAGG - Intergenic
1073068497 10:100778725-100778747 CTGTACATCCTGGGGAGAAGGGG - Intronic
1073407735 10:103312562-103312584 ATATAATTCTTGGGGAAAAAAGG - Intronic
1076464413 10:130668756-130668778 CAGTCCTTCCTGGGGAAGAAGGG - Intergenic
1078102216 11:8336661-8336683 CTGGAGTGCCTGCAGAAAAAGGG - Intergenic
1079016439 11:16872872-16872894 CTTTAGGTACTGGGGATAAAAGG + Intronic
1081183430 11:40013010-40013032 CTGTATTTCCTGGAGACACAGGG - Intergenic
1081395888 11:42585832-42585854 CAGTACTATCTGGGGAAAAAAGG + Intergenic
1082808696 11:57465577-57465599 CAGTTTTGCCTGGGGAAAAAGGG - Intronic
1083443201 11:62690357-62690379 CTCTAGTTCCTGAAGAAAAGGGG - Exonic
1083758048 11:64801929-64801951 CTGTAGGTCCTGGGGAAAAGGGG - Intronic
1083990866 11:66244961-66244983 TGGTGGGTCCTGGGGAAAAACGG - Intergenic
1084389001 11:68862661-68862683 CTGTAGGTGCTGGGGAAGCAAGG + Intergenic
1086401939 11:86468040-86468062 GAGTAGTTCCTGGGAATAAAAGG - Intronic
1088083164 11:105945112-105945134 CTGGAGTTCCTTAGGAAGAAGGG - Intronic
1088801781 11:113313540-113313562 GTCTAGTTCCTGGGCAAGAAGGG - Intergenic
1089776957 11:120844526-120844548 CTGGAGTTCTTGGGGTAGAAGGG + Intronic
1090492544 11:127177473-127177495 CTGTAGTTGCTGGGCAGATATGG - Intergenic
1091457297 12:617555-617577 CTGAAGCTCCTGGGGATAAAAGG + Intronic
1092675074 12:10907624-10907646 AAGTAGTTGCTTGGGAAAAAGGG + Intronic
1096077507 12:48814665-48814687 CTGCAGTTCCTGGAGAAAGGAGG + Intronic
1096497138 12:52045201-52045223 CTGTAGTTCCTGGAGCAGGAGGG + Intronic
1096779682 12:53984806-53984828 CTGTAACTCCTGGGGAGAAGGGG - Intergenic
1096947191 12:55420096-55420118 ATGTATTTCCCGGGGAAACATGG + Intergenic
1098135619 12:67398667-67398689 ATTTAGTTCCTGAGGATAAAAGG - Intergenic
1100331033 12:93582405-93582427 CTGGAGGTCCTTTGGAAAAATGG + Intronic
1101639602 12:106578553-106578575 CTGTGGGTCCCTGGGAAAAAGGG + Intronic
1102912028 12:116723282-116723304 CTGTAGTTTCTGTGAAAAACTGG - Intronic
1103636656 12:122312799-122312821 CTGTGGTTCCTGGAGAAAAAGGG - Intronic
1103720759 12:122974180-122974202 CTGGGCCTCCTGGGGAAAAAGGG + Intronic
1106007672 13:25786472-25786494 CTATAATTCCTGGGTAAAAGAGG - Intronic
1106100352 13:26689955-26689977 TTGTTGTTCATAGGGAAAAAGGG + Intergenic
1110813375 13:79835273-79835295 CTGTATTTGCTGGGAGAAAATGG + Intergenic
1111226237 13:85274815-85274837 CTATGGTTCTTGGGGAATAAGGG - Intergenic
1113772944 13:112923225-112923247 CTGAAGTTCATGGAGATAAAAGG - Intronic
1114065981 14:19060174-19060196 CTGTGCTGCCTGGGGAAGAAGGG + Intergenic
1114096287 14:19339851-19339873 CTGTGCTGCCTGGGGAAGAAGGG - Intergenic
1114305004 14:21414800-21414822 CTGTTTTTAATGGGGAAAAATGG - Intronic
1114650201 14:24279912-24279934 CTGTGGGTCCTGGGGAAGGATGG + Intergenic
1115726182 14:36218470-36218492 ATATACTTCCTGGGGAAATAGGG + Intergenic
1117240844 14:53830721-53830743 CTGGTGTTCCTGAGGAAGAAGGG + Intergenic
1117768264 14:59106289-59106311 CTGAAGTTACAGGAGAAAAAAGG - Intergenic
1118452582 14:65917600-65917622 CTGTGGTTCCTGAGAAAAGAGGG - Intergenic
1120202573 14:81553806-81553828 AGGCAGCTCCTGGGGAAAAATGG + Intergenic
1120208582 14:81612293-81612315 CTGTAGTTCCTGGGAAATGGGGG - Intergenic
1120511541 14:85421661-85421683 CTGTAGTACTGGGGAAAAAAGGG + Intergenic
1120863205 14:89273520-89273542 CTGTAGCCACTGGGGAAGAAGGG + Intronic
1127025423 15:54799952-54799974 CTGCAATTTGTGGGGAAAAAAGG - Intergenic
1127866251 15:63035601-63035623 CTGAAGTTCCTGAGGTAGAATGG + Intergenic
1128602776 15:69011668-69011690 AGATAGTTCCTGGGGAACAAGGG - Intronic
1131384159 15:91989077-91989099 CTGTAGTTTCTGCAGGAAAAGGG - Intronic
1132041120 15:98525262-98525284 CTCTTCTTCCTGGGGAAACAGGG - Intergenic
1133805409 16:9122804-9122826 CTGAAGTTCCCTGGGGAAAAGGG + Intergenic
1134082345 16:11333722-11333744 CTGTCCTGCCTGGGGAAAAGGGG - Intronic
1135084196 16:19461942-19461964 CTGACTTTGCTGGGGAAAAATGG + Intronic
1135496604 16:22956912-22956934 CTGTGGCTCCTGGGGAGAGAGGG + Intergenic
1141458285 16:84159446-84159468 CTGAAGTTCATGTGGAAGAAAGG + Intronic
1141827622 16:86492205-86492227 TTGGAGTTCCCGGGGAATAAAGG + Intergenic
1143048936 17:4106254-4106276 CTGTGACTCCTGGGCAAAAAGGG - Intronic
1143852237 17:9821728-9821750 CTGTAGATTCTGGGGAAGACAGG - Intronic
1143913109 17:10268263-10268285 CTGAAGTTCCTTGGGGAAAAGGG - Intergenic
1144481325 17:15631799-15631821 CTGGGCTTCCTGGGGAAAGAAGG + Intronic
1144659085 17:17056785-17056807 TTGTAGTTGCTGGGGACTAAAGG - Intronic
1144916980 17:18731932-18731954 CTGGGCTTCCTGGGGAAAGAAGG - Intronic
1147843102 17:43386551-43386573 CGATTTTTCCTGGGGAAAAAAGG + Intergenic
1149453823 17:56771116-56771138 TTGTATTTCTTGTGGAAAAATGG - Intergenic
1151098477 17:71527435-71527457 CCGTATTGCCTGGGGAAGAAAGG + Intergenic
1155183826 18:23370640-23370662 CTGTAGTCCTGGGGGAAAAACGG - Intronic
1158514699 18:58121298-58121320 AGGTAGTTCCTGAGGAAAACCGG - Intronic
1160058968 18:75512210-75512232 CTGGTGTTCCTGAGGAAGAAGGG + Intergenic
1161339328 19:3732202-3732224 TAGTAGTAGCTGGGGAAAAAGGG - Intronic
1161777748 19:6273027-6273049 CTGGAGTTCCCTGGGAAAAGAGG + Intronic
1162633068 19:11944086-11944108 CTCTATTACCTGGGGAGAAAGGG + Intronic
1162760346 19:12885250-12885272 CTGTAGTTACAGGGGAAGAAGGG - Intronic
1162852788 19:13444084-13444106 ATGTGGTTCCTGGTGAAACATGG + Intronic
1163674217 19:18647269-18647291 CCGTAGTTACCGGGGAAGAAAGG + Intronic
1165167695 19:33868750-33868772 CTGCATTTGCTGGGGAACAATGG - Intergenic
1202677357 1_KI270711v1_random:19854-19876 CAGGAGTTCCTGGGTAAGAACGG - Intergenic
925215821 2:2095202-2095224 CGTTAGTCCCTGGGGAAAAGGGG + Intronic
927620509 2:24651947-24651969 GTGTAGTTACTGTGGAAAACTGG + Intronic
928226366 2:29451757-29451779 TTGAAGTTCCTGGAGAATAAGGG + Intronic
929086392 2:38171601-38171623 CTGTAGATCCTAGTGAAAGATGG - Intergenic
929989188 2:46770590-46770612 CTGTAGCACTTGGGGAAGAATGG + Intergenic
930661881 2:54063038-54063060 GGGGAGTTCCTGGGGAACAATGG + Intronic
931701419 2:64912346-64912368 CTGTAGTGCATTGGGAATAAAGG - Intergenic
932568633 2:72924943-72924965 CTGCTGTTCCTGGGCAAAACTGG + Intronic
933189604 2:79319698-79319720 CAGAAATTCCTGGGAAAAAATGG - Intronic
936852252 2:116914709-116914731 ATGTATTTCCTGGGGACAATAGG + Intergenic
937631692 2:124109196-124109218 CTGATGTCCCAGGGGAAAAAGGG + Intronic
937681282 2:124647527-124647549 CTGTAGAGCCTGTGGGAAAAGGG + Intronic
939173668 2:138724568-138724590 AAATAGTTCCAGGGGAAAAATGG - Intronic
941961025 2:171253623-171253645 ATGAAGTGCCTGGGTAAAAAGGG + Intergenic
941983390 2:171485353-171485375 CAGCAGTTCCTGGGGAAGGAAGG - Intergenic
942397957 2:175571926-175571948 CTGTAGTGCATGGAGAGAAATGG + Intergenic
943048205 2:182883755-182883777 CTGGAGTTACGGGGGAGAAATGG - Intergenic
943968733 2:194374768-194374790 CTGTACTTCCTGTGGGAAAGAGG + Intergenic
944978180 2:205082242-205082264 ATGTATTTCCTGTGGATAAAGGG - Intronic
945814780 2:214590872-214590894 CTCAAAGTCCTGGGGAAAAACGG - Intergenic
946440993 2:219695726-219695748 CTGTAGTATATCGGGAAAAATGG - Intergenic
947348332 2:229217142-229217164 CTGTAGATCCTGGACAAAAATGG - Intronic
1172187793 20:33042065-33042087 CTGTAGTTCCGAGGGAGAATAGG - Intronic
1172208250 20:33179855-33179877 CTGGGGTTGCTGGGGAGAAATGG + Intronic
1172610457 20:36247483-36247505 CTGGAGTTGATGGGGGAAAACGG - Intronic
1175570217 20:60012513-60012535 ATGGAGTTTCTGGGGAAAAGTGG - Exonic
1178103776 21:29297856-29297878 CTGGAGTTCCCGGGGCAAAAAGG - Intronic
1179280738 21:39931729-39931751 CAGGAGTTCCTGGGTAAATAAGG + Intergenic
1180484461 22:15782766-15782788 CTGTGCTGCCTGGGGAAGAAGGG + Intergenic
1181912083 22:26246511-26246533 CTGGAGTTAGAGGGGAAAAATGG - Intronic
1182343829 22:29645134-29645156 CTGTCATTTGTGGGGAAAAAAGG + Intronic
1182499629 22:30736996-30737018 CAGAAGTTCCTGTGGAAAAATGG - Intronic
1182895451 22:33855660-33855682 CTGTGGTTCCTGGGGGCAGAGGG - Intronic
1183343236 22:37293670-37293692 CTGCAGATCCTGGGGAGAAAGGG + Intronic
1185161870 22:49234807-49234829 CTGTAGTGCCTGGGGTGAAGAGG - Intergenic
949159086 3:859190-859212 CTGGAGTCCCAGGGGGAAAATGG - Intergenic
949623066 3:5837776-5837798 CTGCAATTCCTGGGTAAATAAGG - Intergenic
949660929 3:6277497-6277519 ATTTTTTTCCTGGGGAAAAATGG + Intergenic
952622326 3:35360803-35360825 ATGTAGCTAATGGGGAAAAAAGG - Intergenic
952629893 3:35453542-35453564 GTGTGCTTCCTGGGGAAACACGG - Intergenic
955837503 3:63072733-63072755 CTGTTTTTCCTGGGGTCAAATGG + Intergenic
958555481 3:95670421-95670443 CTATACTGCCTGGGGAAACAGGG + Intergenic
959089308 3:101885378-101885400 GTGTTTTTCCTGGGGAAACAGGG - Intergenic
960626080 3:119683558-119683580 CTGTAGTTCCTTGCCAAATAGGG + Intergenic
961218396 3:125180092-125180114 CTGGAGTTACTGGGAACAAAAGG - Intronic
961532217 3:127546865-127546887 CTGAAGTTCTAGGGGGAAAAAGG + Intergenic
963238030 3:142974647-142974669 CAGTGGTCCCTGGGGTAAAATGG + Intronic
964466043 3:156994368-156994390 GTGTAGTTCATAGGGAAACAAGG + Intronic
964491571 3:157241853-157241875 ATGTTGTTGATGGGGAAAAAGGG + Intergenic
965154167 3:165025377-165025399 CTGGTGTTCCTGAGGAAGAAGGG + Intronic
967154722 3:186681896-186681918 CTGGAGTCCCTGGAGAAGAAGGG - Intergenic
967320957 3:188194598-188194620 CTGTAGTTCTTGAGGGAAGAAGG + Intronic
968226533 3:196975912-196975934 CTGTTTTTCCTGGGGCAAATAGG + Intergenic
968278559 3:197458846-197458868 CTTTTCTTCCTGGGGAAAAAAGG - Intergenic
970994797 4:22253351-22253373 CTGTCCTTCCTGGACAAAAATGG - Intergenic
973339260 4:48986876-48986898 CTACAGCTCCTGGGGAAAACGGG - Intronic
976350195 4:84051982-84052004 CCGTTGTTCCTTAGGAAAAAAGG + Intergenic
977239153 4:94545426-94545448 ATGTTTTTCCGGGGGAAAAAAGG + Intronic
981310675 4:143295045-143295067 CTATAATACCAGGGGAAAAAAGG + Intergenic
981616691 4:146650242-146650264 CTGTGTTTCCCGGGGAAAACAGG + Intergenic
983335189 4:166382980-166383002 CAGTAGCTCCTGGGAAACAAGGG + Intergenic
984123569 4:175776810-175776832 GTGGAGTTCCTGGGAACAAAGGG + Intronic
988026455 5:25697838-25697860 GTATAGTTCCTGGGAATAAATGG + Intergenic
988951617 5:36267543-36267565 CTGTAGTTCCTGGGTAGAGGGGG + Intronic
990019168 5:51104128-51104150 CAGTAGATCCTTGGGAAATATGG - Intergenic
990124610 5:52498790-52498812 CTGTATTTCCTGGCTCAAAATGG - Intergenic
991225829 5:64270424-64270446 CTGAAATTCCTGGGGAAGGAAGG - Intronic
991295515 5:65076104-65076126 CTGCAGCTCCTGGGGAGGAAAGG + Intergenic
996024517 5:118629896-118629918 CAGTATTTCCTGTGGCAAAATGG + Intergenic
996111582 5:119572289-119572311 TTGTGGTCACTGGGGAAAAATGG + Intronic
996729968 5:126707460-126707482 CTGCAGTAATTGGGGAAAAAAGG + Intergenic
998219789 5:140267585-140267607 ATTTAGTTCCTGGGGAGAAAGGG - Intronic
998407151 5:141880372-141880394 CCCTCTTTCCTGGGGAAAAAAGG - Intergenic
999577481 5:152995517-152995539 CTGTAGGTCCTGGGGATTAGAGG + Intergenic
1001278678 5:170369977-170369999 ACTTAATTCCTGGGGAAAAAGGG - Intronic
1003777459 6:9384926-9384948 CTTTAGTTAATGGGGAAAAATGG + Intergenic
1004904758 6:20226904-20226926 TTGTAGATCATGGGGGAAAAAGG - Intergenic
1004914900 6:20322438-20322460 CTGTATCTGCTGAGGAAAAATGG + Intergenic
1005473834 6:26188181-26188203 CTGTAGCTGCTGGAGAAACAAGG - Intergenic
1006635126 6:35456453-35456475 CTGTAGTTCCTGGAGGAAGAAGG + Intronic
1007289804 6:40777222-40777244 CTGTGGTCCCTGGGGAAACAAGG - Intergenic
1007667827 6:43526213-43526235 ATTTAGTTACTGGGGATAAAAGG + Intronic
1011543518 6:88459224-88459246 CTGTATTCCTTAGGGAAAAATGG + Intergenic
1012173211 6:96045668-96045690 GTGTAGTTCCTGTAGAGAAAAGG + Intronic
1013275493 6:108580913-108580935 CTCTAGAGCCTGGAGAAAAAAGG - Intronic
1014172880 6:118298427-118298449 CTCTAGTTCAAGGGGAAATAAGG - Intronic
1015280130 6:131424220-131424242 CTGTAGTTCATAGTGATAAAAGG + Intergenic
1015437828 6:133210027-133210049 CTGTACTTCCTGGGTCAAATGGG - Intergenic
1016672079 6:146720930-146720952 CTGAAGCTCCTGTGGAAAGAAGG + Intronic
1019355290 7:575491-575513 CTGTCTTTCCTGTGGAAAAGGGG - Intronic
1021680951 7:23131295-23131317 TTCAAGTTCCTGGGAAAAAAGGG - Intronic
1023361567 7:39422117-39422139 TTGTAGTCACTGGGGAAAAAAGG + Intronic
1024590831 7:50881512-50881534 GAGTAGTTGCTGGGGAATAAGGG - Intergenic
1027400024 7:77797956-77797978 CTGAAGTTCCAGGGGCAAATAGG - Intronic
1027945842 7:84745025-84745047 CTGTAGTTCCATGGGGAAAATGG - Intergenic
1028147640 7:87336088-87336110 TGGTAGCTCCTGAGGAAAAAAGG - Intergenic
1031274370 7:119699976-119699998 CTGTAATTCCTTGGGGAGAAAGG - Intergenic
1031383976 7:121123307-121123329 CTGGATTGCCTGTGGAAAAACGG - Intronic
1032007713 7:128317000-128317022 CTGTATGTCCTGGGGGAAGATGG + Intronic
1032897462 7:136267109-136267131 CTATACTTCCTGGTGAAAAATGG + Intergenic
1033416059 7:141162129-141162151 CTGCAGTTCCTGTGGGGAAACGG - Intronic
1034906529 7:154952715-154952737 CTGTAGTCTCTGGGTAAACACGG - Intronic
1038479549 8:27892443-27892465 CTGTGGGTCCTGGGGAAATTAGG + Intronic
1039251025 8:35664249-35664271 CTACAGATCCTGGGGTAAAATGG + Intronic
1040692272 8:49953420-49953442 CTCTAGTTCCCAGGGAAATATGG - Intronic
1040882482 8:52221785-52221807 CTGTAGTTCCTGGGGAAAAATGG + Exonic
1043413501 8:80024795-80024817 CTGTAGTTCCTGAAGAACAAGGG - Intronic
1043963122 8:86440705-86440727 CTGATGTTCCTGAAGAAAAATGG - Intronic
1044758918 8:95496160-95496182 CTGCAGTTCCAGTGGAGAAATGG - Intergenic
1044787065 8:95805637-95805659 CAGGAGTTACTGGGAAAAAAGGG - Intergenic
1045540389 8:103078779-103078801 CTGTATTTCCCCTGGAAAAACGG - Intergenic
1048033614 8:130656004-130656026 CTTTGGTTGCTGGGGAAGAATGG - Intergenic
1048339359 8:133526809-133526831 CTGTTGTTCCTGGGGCAGAGTGG + Intronic
1048718887 8:137299675-137299697 CTGTCCTTCCTTGGGAACAAGGG - Intergenic
1048823646 8:138402079-138402101 CTGAAGTTCCACGGGCAAAAGGG + Intronic
1049629213 8:143643244-143643266 CTGGAGGCCCTGGGGAAAACTGG - Intronic
1051351442 9:16201508-16201530 ATGTTGTTCCTGATGAAAAAAGG - Intergenic
1051722824 9:20056183-20056205 CTTTTGTTTCTTGGGAAAAATGG - Intergenic
1052171969 9:25410480-25410502 CTGTTTTTCCTGGGCATAAAGGG - Intergenic
1056925642 9:90832136-90832158 CAGTTGCTCCTGGGGAAATATGG - Intronic
1059073652 9:111166432-111166454 CTCTAGTTCCTGGGAAAGCAGGG - Intergenic
1061239528 9:129361538-129361560 CTGGAGATCCTGGGGAAGTATGG - Intergenic
1061791038 9:133059005-133059027 CTGTATTTCCTGGGGACAGGTGG + Intergenic
1061896708 9:133652115-133652137 CTGTAGAGGCTGGGGCAAAATGG + Intronic
1062151799 9:135023275-135023297 CTGTAGCTGCTGGGGATGAAGGG - Intergenic
1062509193 9:136895518-136895540 CTGTCCTTCCTGGAGAAAAAAGG + Intronic
1186257893 X:7742378-7742400 CTGCAGTCCCAGGGGAAGAAGGG + Intergenic
1187714340 X:22087468-22087490 CTCTTGTTTCAGGGGAAAAAAGG - Intronic
1188006455 X:25019084-25019106 CTGTTGTTTATGGTGAAAAATGG + Intergenic
1189226142 X:39414852-39414874 TTTTATTTCTTGGGGAAAAAAGG + Intergenic
1190718896 X:53130452-53130474 CTGTAGTTTCTTCGTAAAAATGG + Intergenic
1191199719 X:57766747-57766769 CTGAAGTTCTTGGGGATAGATGG - Intergenic
1193656467 X:84204051-84204073 TTGTAGTTACTGGTGTAAAATGG - Intergenic
1196161456 X:112488515-112488537 TTGTTGTTCCTGAGGAAGAAGGG + Intergenic
1197107335 X:122731978-122732000 CTGGAGGTCCTGGGGGGAAAGGG + Intergenic
1198532998 X:137563662-137563684 CTGTAGTCCCTGGAACAAAAAGG - Intergenic
1200228251 X:154431268-154431290 CTGTAGGTTGTGGAGAAAAAGGG + Intronic
1201737011 Y:17278208-17278230 CTTTAGTGGCTGGGGAGAAAGGG + Intergenic