ID: 1040887564

View in Genome Browser
Species Human (GRCh38)
Location 8:52282549-52282571
Sequence CTACATACAGTGATGGAGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 209
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 194}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040887564_1040887570 -2 Left 1040887564 8:52282549-52282571 CCAACCTCCATCACTGTATGTAG 0: 1
1: 0
2: 2
3: 12
4: 194
Right 1040887570 8:52282570-52282592 AGGGACCTCCCTGGCACCCCTGG No data
1040887564_1040887574 13 Left 1040887564 8:52282549-52282571 CCAACCTCCATCACTGTATGTAG 0: 1
1: 0
2: 2
3: 12
4: 194
Right 1040887574 8:52282585-52282607 ACCCCTGGTCTGCCTTGTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040887564 Original CRISPR CTACATACAGTGATGGAGGT TGG (reversed) Intronic
902121189 1:14167424-14167446 CTAAATACAAGGATGGAGGCAGG + Intergenic
902862393 1:19255783-19255805 CTAATTTCAGTAATGGAGGTAGG + Intronic
903016329 1:20364461-20364483 CTTCTTACAGTTATGGAGGCTGG - Intergenic
903462017 1:23526826-23526848 GTACATGCAGTGATGGGGGCAGG - Intronic
904014632 1:27410013-27410035 CTACAGGCGGTGGTGGAGGTGGG + Exonic
906276415 1:44519695-44519717 CTACATGGAGAGATGGAGGGAGG - Intronic
908507767 1:64822567-64822589 CCTCATACAGTGCTGGGGGTTGG + Intronic
912510817 1:110189052-110189074 CTGCATTCAGTGTTGGAGATAGG + Intronic
917034810 1:170736491-170736513 CTTCATACAATCATGGGGGTGGG - Exonic
917640148 1:176975475-176975497 CTACATACAGGGCTGTTGGTTGG + Intronic
918838394 1:189500650-189500672 CTACATACAGTGATCAAGAAAGG - Intergenic
919504851 1:198385954-198385976 CTACATATGGTCATGGAGGAGGG - Intergenic
921546285 1:216478570-216478592 TTTCTTACAGTGATGGAGGCCGG - Intergenic
923427031 1:233881269-233881291 CTAAATGCAGAGATGGAGGTGGG - Intergenic
923949748 1:238935891-238935913 TTACATACAGTTCTGGAGGCTGG + Intergenic
1065695553 10:28376558-28376580 TTAAATGCAGGGATGGAGGTGGG - Intergenic
1067227287 10:44384515-44384537 CTGCGCACAGTGCTGGAGGTCGG - Intronic
1068891569 10:62153849-62153871 CAATCCACAGTGATGGAGGTGGG + Intergenic
1070971049 10:80567566-80567588 CTATATACAGTGCTGGAGCAGGG + Intronic
1075240755 10:120776237-120776259 CTGCCTGGAGTGATGGAGGTAGG + Intergenic
1075859497 10:125662376-125662398 ATACCTACATTGCTGGAGGTTGG - Intronic
1078579777 11:12529383-12529405 AAACATACAGAGATAGAGGTGGG + Exonic
1079376565 11:19897492-19897514 CTAAATTCAGTGATGATGGTAGG - Intronic
1081250099 11:40819407-40819429 CTCCATCCAGTGGTGGAAGTGGG - Intronic
1082616662 11:55369598-55369620 TTTCATACTGTGATGGAGTTAGG + Intergenic
1082938724 11:58680886-58680908 CAAAATACAGGGATGGAGGAAGG + Intronic
1083589470 11:63884850-63884872 CTGGATACAGTGAGGGAGGAAGG + Intronic
1085773958 11:79349007-79349029 CTCCATACAGTGAAGGGGCTTGG - Intronic
1090402299 11:126456619-126456641 CTTCAGACAGTCCTGGAGGTGGG + Intronic
1091487604 12:904971-904993 CCACTTACAGTGTTGTAGGTAGG + Intronic
1091654244 12:2333661-2333683 CTGCAGAGAGAGATGGAGGTTGG + Intronic
1091823822 12:3494583-3494605 AGAGATGCAGTGATGGAGGTGGG + Intronic
1093079742 12:14795786-14795808 ATATATCCAGTGGTGGAGGTTGG + Intronic
1093543575 12:20317963-20317985 CTTCTTACAGTTCTGGAGGTTGG - Intergenic
1097677676 12:62620517-62620539 TTACAGACAGTGATGGGGCTAGG - Intergenic
1097766287 12:63530875-63530897 ATAAATACAGTCCTGGAGGTAGG - Intergenic
1097782723 12:63726712-63726734 ATAAATACAGTCCTGGAGGTAGG - Intergenic
1102526825 12:113518541-113518563 CTGCATACAGTCTAGGAGGTAGG - Intergenic
1104461610 12:128961052-128961074 TTACATACAGTAAAGGATGTGGG + Intronic
1105729283 13:23195848-23195870 CTAAATACAGTAATGAAGTTGGG + Intronic
1107877584 13:44804300-44804322 CTTCTTACAGTTCTGGAGGTTGG + Intergenic
1112243895 13:97710560-97710582 CAACATGCAGTGATGGAGCAGGG - Intergenic
1113087430 13:106582497-106582519 TTTCTTACAGTTATGGAGGTTGG - Intergenic
1116715438 14:48419987-48420009 ATACACCCAGTGTTGGAGGTGGG + Intergenic
1117398479 14:55335929-55335951 CTACATTCAGTCATGTAGGAAGG - Intronic
1117559396 14:56921259-56921281 TTAGATAAAGTTATGGAGGTTGG + Intergenic
1120526743 14:85585134-85585156 CTACCTACAAGGTTGGAGGTGGG + Intronic
1123736656 15:23191074-23191096 CGACCTCCAGTGTTGGAGGTGGG + Intergenic
1123785754 15:23671028-23671050 CTCCTCACAGTTATGGAGGTTGG - Intergenic
1124090633 15:26596854-26596876 TTTCTTACAGTGATGGAGGTTGG + Intronic
1124287881 15:28419751-28419773 CGACCTCCAGTGTTGGAGGTGGG + Intergenic
1124295345 15:28497576-28497598 CGACCTCCAGTGTTGGAGGTGGG - Intergenic
1125551648 15:40549585-40549607 CCACATAGAATGATGGAGGGGGG - Intronic
1127534385 15:59876447-59876469 CTACATAGAGTGATGGAAGTGGG + Intergenic
1131047691 15:89326579-89326601 CTAGATACACTGCTGGGGGTGGG + Intronic
1131437369 15:92434032-92434054 CTACATACATTGTTGGAGACAGG - Intronic
1133561632 16:6956000-6956022 TTACAAAAAGTGATGGAGGCCGG - Intronic
1135037893 16:19093463-19093485 TTACTTACAGTTATGGAGGCTGG - Intergenic
1137297942 16:47114890-47114912 TTAAATACAGTGTTGGATGTAGG + Intronic
1140593153 16:76376961-76376983 ATACATACATGTATGGAGGTTGG + Intronic
1141617680 16:85219611-85219633 CGACATTCGGAGATGGAGGTGGG - Intergenic
1141949427 16:87331131-87331153 CTACATAAAGTGCTGGGGGGTGG + Exonic
1144701937 17:17346089-17346111 CTGGACGCAGTGATGGAGGTGGG - Intronic
1146434260 17:32828639-32828661 CTACATGCAGAGAGGGAGGGAGG + Intronic
1147566611 17:41540346-41540368 CTATATAAACTGCTGGAGGTAGG - Intergenic
1148224110 17:45886269-45886291 CTACAGAGAGTTATGGAAGTGGG - Intergenic
1149879871 17:60278918-60278940 ATACACACAGTGTTGGAGTTTGG - Intronic
1151295517 17:73183189-73183211 CTACATACAGAGGTGGGGGCAGG + Intergenic
1152923599 17:83078008-83078030 GTACCTGCAGTGATGGGGGTGGG + Intergenic
1153660278 18:7319917-7319939 CTACAGACAGCGATGGAGCTTGG - Intergenic
1154302770 18:13208773-13208795 CTTCTTACAGTTCTGGAGGTGGG - Intergenic
1158005268 18:52664911-52664933 CTGCATTCAGTGTTGGAGGGAGG - Intronic
1158251987 18:55499501-55499523 CTACATAAACAGATGGAGCTAGG - Intronic
1159911547 18:74151074-74151096 TTACATCCGGTGATGGAGGGCGG + Intronic
1162175516 19:8827175-8827197 CTGGATACAGTGCTGGAGGATGG + Intronic
1162782944 19:13016380-13016402 CTACAGACAGGTATAGAGGTAGG + Intronic
1164421235 19:28094967-28094989 TTACATACAAAGAGGGAGGTGGG + Intergenic
1165579308 19:36848732-36848754 CCCCATACAGAGATGGGGGTTGG + Intronic
1165986393 19:39772786-39772808 CTGCTTACAGTTATGGAGGCTGG + Intergenic
1167305423 19:48705748-48705770 GTGCATACAGTCATGGAGTTGGG + Exonic
925843772 2:8017611-8017633 CTGCAGACAGTGATGGTGGCAGG + Intergenic
926846963 2:17152037-17152059 CCACAGACAGTGATGGAGGAGGG + Intergenic
927052782 2:19347335-19347357 CTACACAAAGTGAATGAGGTAGG + Intergenic
930598513 2:53416478-53416500 TTTCCTACAGTTATGGAGGTTGG - Intergenic
931924798 2:67060334-67060356 CTATAGCCACTGATGGAGGTGGG - Intergenic
932473405 2:71980681-71980703 CTTCATACAATGATGTAGGGAGG - Intergenic
932839653 2:75070198-75070220 ATACATACAATGTTGGGGGTAGG - Intronic
933384849 2:81597147-81597169 TTACTTACAGTTCTGGAGGTTGG - Intergenic
935037588 2:99393832-99393854 CGACAAGCAGTGATGGAGGAAGG + Intronic
935214888 2:100968271-100968293 CTACCGACAGTGATGCAGTTTGG + Exonic
936706817 2:115085289-115085311 ATACACACATTGGTGGAGGTGGG - Intronic
937981765 2:127619945-127619967 CTGCATTCAGGGAGGGAGGTGGG + Intronic
940939335 2:159540013-159540035 CTCCAAACAGGGATGGAGGAAGG - Intronic
941718164 2:168785700-168785722 CTCAATACAGTTAGGGAGGTAGG + Intergenic
941934138 2:170970218-170970240 CTGCAGCCATTGATGGAGGTGGG + Intergenic
944998909 2:205327052-205327074 ACACATACAGTGATAGAGCTGGG - Intronic
947309785 2:228788800-228788822 CTACAGTCAGTGGTGGAGGTGGG + Intergenic
1170149851 20:13218425-13218447 CTAGATACTGGGATGGAGGTGGG + Intergenic
1171904160 20:30886743-30886765 CAAAATAAAGTGATGGAGGAAGG - Intergenic
1172030655 20:31979936-31979958 ATTCATACAGTGAGGGATGTGGG + Intronic
1174217802 20:48930609-48930631 CTACATGGAGTGGTGGAGGGAGG + Intronic
1174449616 20:50611152-50611174 CTGCATACGGTGAGTGAGGTGGG - Intronic
1176741335 21:10606148-10606170 TTACACACAGACATGGAGGTTGG + Intergenic
1177103633 21:16926179-16926201 TTTCTCACAGTGATGGAGGTGGG - Intergenic
1177386733 21:20418865-20418887 CAAAATACAGTGGTGGAGGCAGG - Intergenic
1177609665 21:23430694-23430716 CTTCTTACAGTTCTGGAGGTCGG - Intergenic
1177779699 21:25608679-25608701 ATACATATAGTGTTGGAGGGCGG + Intergenic
1178088512 21:29136954-29136976 ATACAAATAGTGTTGGAGGTAGG - Intronic
1180022542 21:45137602-45137624 CTGCGTTCAGTGATGGAGCTTGG + Intronic
1183041249 22:35179791-35179813 GAACATACAGTCATGGAGGAAGG + Intergenic
949846341 3:8374168-8374190 CAAAATACAGGGATGGAGGAAGG + Intergenic
952137448 3:30439247-30439269 ATACAAAAAGTGATGGTGGTAGG + Intergenic
952603869 3:35120074-35120096 CAAAATACAGTGATGTAAGTAGG - Intergenic
953875668 3:46665436-46665458 CTCCATGCAGGGATGGAGGTGGG - Intergenic
954929593 3:54269580-54269602 CTTTACACAGTGATGGTGGTTGG - Intronic
955164694 3:56499592-56499614 CTTCATACAGTTCTGGAGGCTGG - Intergenic
955335498 3:58082096-58082118 CCACAGTCAGTGATGGGGGTGGG + Intronic
957937513 3:86963950-86963972 CTACACACATTCATGCAGGTGGG - Intronic
958704327 3:97634677-97634699 CTGAATCCAGTGATTGAGGTAGG + Intronic
959562258 3:107796095-107796117 CTTCATTCAGAGATGGAGGTTGG - Intronic
963840325 3:150098136-150098158 TTACTTACAGTTATGGAGGCTGG - Intergenic
964506385 3:157404656-157404678 CTACAACCAGTGATGGGAGTTGG - Intronic
965476812 3:169166032-169166054 CTCCCTACAGTTAGGGAGGTGGG - Intronic
968781719 4:2587400-2587422 CCACACCCAGTGCTGGAGGTGGG - Intronic
968897608 4:3413883-3413905 CTACACACAGGGATGGAGCAGGG - Intronic
968929481 4:3571004-3571026 CTACATCCAGTCATGGGGGAAGG - Intergenic
970176637 4:13346189-13346211 CAACCTCCAGTGTTGGAGGTGGG + Intergenic
972109420 4:35538978-35539000 CTACTTACAGGGATGGGGTTGGG - Intergenic
972556972 4:40191321-40191343 CTACATCCAGTGAATAAGGTGGG + Intronic
973046477 4:45540306-45540328 TAATCTACAGTGATGGAGGTGGG + Intergenic
973329668 4:48900227-48900249 CCACATAGAGGCATGGAGGTAGG - Intronic
974921460 4:68245693-68245715 CTACATCCAGTGTTGGAGCTTGG + Exonic
975905726 4:79209797-79209819 ATACTTTCAGAGATGGAGGTGGG + Intergenic
976138945 4:81970312-81970334 CTACATACATATATGGATGTTGG + Intronic
977749530 4:100592663-100592685 TTACATACTTTGAAGGAGGTAGG + Intronic
979188048 4:117823888-117823910 CTACTAATAGTGATAGAGGTAGG + Intergenic
980220431 4:129906437-129906459 ATACAAAGATTGATGGAGGTAGG - Intergenic
984720228 4:182965138-182965160 TTTCTTACAGTTATGGAGGTTGG - Intergenic
986928744 5:12793620-12793642 ATACATCCAGTGAGGTAGGTAGG + Intergenic
990820631 5:59835948-59835970 CAACACAAAGTGATGGAGGTAGG - Intronic
990981768 5:61607746-61607768 GTACATACAGAGATGGTGGTAGG - Intergenic
991292311 5:65044834-65044856 CAAGATTCAGTGATGGTGGTGGG - Intergenic
992419608 5:76589551-76589573 CTACAGACAGAGATGGATGCAGG - Intronic
993372066 5:87105090-87105112 CTACATACTGTGCTAGAGCTGGG + Intergenic
993768704 5:91895752-91895774 CTTCTCACAGTTATGGAGGTTGG - Intergenic
996757376 5:126948928-126948950 CGGCCTACAGTGGTGGAGGTGGG + Intronic
997903439 5:137790259-137790281 CTTCATACAGTTTTGGAGGCTGG + Intergenic
998427142 5:142038493-142038515 CTACTTACAATGCTTGAGGTAGG - Intergenic
1001897417 5:175393285-175393307 ATGCATGCTGTGATGGAGGTGGG - Intergenic
1004512589 6:16294913-16294935 CTACAGAAAGTGCTGGAGCTGGG + Intronic
1004777066 6:18859540-18859562 TTAAATAGGGTGATGGAGGTAGG + Intergenic
1005641998 6:27805265-27805287 CTACAGACAGGGATGGATGGAGG - Intergenic
1007366065 6:41394003-41394025 CTACCTATAGTGAAAGAGGTTGG - Intergenic
1007721074 6:43885787-43885809 ACACAGACAGTGGTGGAGGTAGG - Intergenic
1010357796 6:74954824-74954846 CTACATTCAGTGACTGAAGTAGG + Intergenic
1011378763 6:86719916-86719938 AAACTTACAGTCATGGAGGTAGG + Intergenic
1012364783 6:98425168-98425190 CTTCTCACAGTTATGGAGGTTGG - Intergenic
1012444964 6:99297817-99297839 CTTCATGCAGTGGAGGAGGTAGG - Intronic
1012919110 6:105202751-105202773 CTTCTTACAGTTTTGGAGGTTGG - Intergenic
1013392589 6:109701680-109701702 CTACTTTCTGTGATGGGGGTGGG - Intronic
1013837221 6:114346609-114346631 CCAAATACAGTGATGGAGCATGG - Intergenic
1014051279 6:116958326-116958348 CTACAAACAGAAATGGAAGTGGG + Intergenic
1014412727 6:121146969-121146991 CTAGATAGGGTGATGGAGGGAGG - Intronic
1014614425 6:123584123-123584145 ACAGATACAGTCATGGAGGTCGG + Intronic
1014811654 6:125893541-125893563 ATTCATTCAGTGATGGAGTTGGG - Intronic
1015098905 6:129451229-129451251 CTACATACAGTGTTGAGAGTAGG - Intronic
1016376104 6:143422104-143422126 CTATATACAGTCATGGGTGTTGG - Intergenic
1017608462 6:156158347-156158369 CTAGAGACAAAGATGGAGGTAGG + Intergenic
1017749700 6:157479897-157479919 CTACTTTCACTCATGGAGGTGGG - Intronic
1023613910 7:41999242-41999264 GTGCATACAGTGATGAAGGCAGG - Intronic
1024370745 7:48580910-48580932 TCACAGGCAGTGATGGAGGTGGG - Intronic
1027220911 7:76213406-76213428 CAACATCCAATGATGTAGGTCGG + Intronic
1027270467 7:76515854-76515876 CTACATACAGTGTTAGACTTGGG + Intronic
1030017466 7:105238613-105238635 CTAGTTACAGTGATTGAAGTAGG - Intronic
1031117537 7:117684099-117684121 CTACATTCTGTCATGGAGGCAGG - Intronic
1032257999 7:130312104-130312126 TTACAGACAGTGGTGCAGGTGGG - Exonic
1032869319 7:135965710-135965732 CTACAAACAGTGTGGGAAGTTGG + Intronic
1035109681 7:156470774-156470796 CTATCTCCAGTGTTGGAGGTGGG + Intergenic
1040499838 8:47996642-47996664 CTCCATGCAGTGATGGCAGTGGG + Intergenic
1040887564 8:52282549-52282571 CTACATACAGTGATGGAGGTTGG - Intronic
1043783886 8:84372435-84372457 CTGCATACAGTAATAGAGGTGGG + Intronic
1045386634 8:101677432-101677454 CTATATACAATCTTGGAGGTAGG - Intergenic
1045810409 8:106214682-106214704 CTATTTACAGTTCTGGAGGTTGG - Intergenic
1046789711 8:118307911-118307933 CCACCTACAGTGAAGGAGGCCGG - Intronic
1046824503 8:118672576-118672598 CTTCATACACTGATGGAAATTGG - Intergenic
1047298041 8:123588605-123588627 CTACATACAGGGCAGGACGTTGG - Intergenic
1048026139 8:130588693-130588715 ACACATCCAGTGATTGAGGTAGG + Intergenic
1049036946 8:140084161-140084183 CAACATACAATGATTGAGGCTGG + Intronic
1049869411 8:144962067-144962089 CTTCATACAGTGATTTAGGGAGG + Intergenic
1052508749 9:29387366-29387388 TTAAATACAGTGGTGTAGGTAGG - Intergenic
1053804173 9:41784440-41784462 CTACATCCAGTCATGGGGGAAGG - Intergenic
1054192481 9:61995936-61995958 CTACATCCAGTCATGGGGGAAGG - Intergenic
1054460797 9:65461462-65461484 CTACATCCAGTCATGGGGGAAGG + Intergenic
1054645925 9:67592755-67592777 CTACATCCAGTCATGGGGGAAGG + Intergenic
1055316746 9:75041633-75041655 TCACATACAGTGATGGAGGTGGG - Intergenic
1056323368 9:85457599-85457621 CTACATACAGTTATAGCGTTGGG - Intergenic
1057750712 9:97790521-97790543 CGACATACAGAGATGGGTGTGGG + Intergenic
1058136972 9:101317858-101317880 TTACACACAGTGATGTAAGTTGG + Intronic
1188166773 X:26872631-26872653 CTATATACAGTGATATAGTTGGG - Intergenic
1188653308 X:32658740-32658762 TTATATACAGCAATGGAGGTAGG - Intronic
1189468148 X:41293543-41293565 CTAAATACAGTGGTGGATGAGGG + Intergenic
1193150392 X:78118621-78118643 CTACATACAGAGGTGTGGGTAGG + Intronic
1195248164 X:103015578-103015600 CAACCTCCAGTGTTGGAGGTGGG + Intergenic
1197235868 X:124062097-124062119 CTACATTCAGTCATGAAGGCAGG - Intronic
1198147526 X:133872463-133872485 CAACAAACAGTGCTGGAGCTTGG + Intronic
1198474283 X:136980980-136981002 CAACATAAAGGGATGGAGGAAGG - Intergenic
1200520225 Y:4202436-4202458 CCAAGTACAGTGATGGGGGTGGG - Intergenic
1201262500 Y:12173975-12173997 CTGCATACAGCGAAGCAGGTTGG - Intergenic
1201901537 Y:19049140-19049162 GTACTTCCAGAGATGGAGGTGGG + Intergenic