ID: 1040891535

View in Genome Browser
Species Human (GRCh38)
Location 8:52322242-52322264
Sequence GTGGTAAAAATGAGAATTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 311
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 287}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040891535 Original CRISPR GTGGTAAAAATGAGAATTGT AGG (reversed) Intronic
902515896 1:16989509-16989531 ATGCTAAAAATAATAATTGTAGG - Intronic
902949793 1:19873388-19873410 GTGGAAAAAATGAGAGCAGTTGG - Intergenic
902969771 1:20038900-20038922 GTGGGGAAAATGAGAATAGGAGG - Intronic
903609302 1:24598414-24598436 GTGGTAAAAGTCAGAATAGCAGG - Intronic
903933572 1:26879047-26879069 CTGTTAAAACTGAAAATTGTGGG + Exonic
906889950 1:49699745-49699767 GTGGACAAAATGAGATATGTAGG + Intronic
907156002 1:52334515-52334537 GTTGTAAGCATCAGAATTGTTGG + Intronic
907164214 1:52395973-52395995 GTGATAAAAATGATAATTTATGG - Intronic
908244295 1:62215467-62215489 GTGGTAAAAATGAGAATGCAAGG - Intergenic
910208048 1:84767103-84767125 GTATTAATAATGAGAATTATAGG - Intergenic
910503518 1:87923032-87923054 TTGGTACAAAAGATAATTGTGGG + Intergenic
910632879 1:89374579-89374601 GAGTTAAAAATAACAATTGTCGG - Intronic
911270356 1:95794296-95794318 TTACTAAAAATGAGAATTTTAGG + Intergenic
913440510 1:118892012-118892034 GAAATAAAAATGAGAATGGTAGG + Intronic
915640264 1:157219247-157219269 TTGGTAGAAATGGGAATTTTCGG + Intergenic
915849796 1:159309400-159309422 TTGGAAAAAATGGGACTTGTGGG - Intergenic
916611751 1:166398320-166398342 GTGGTGAAAATGAGATTTGTAGG + Intergenic
917354196 1:174108950-174108972 CTGGTAAGAAAGAGGATTGTGGG + Intergenic
919188293 1:194182789-194182811 TTGGTACAAGTGACAATTGTGGG - Intergenic
921884173 1:220287843-220287865 GTGGGGAAAATGAGAATCGGGGG - Intergenic
922040405 1:221890763-221890785 GAGGTAAAAATGAAATGTGTGGG - Intergenic
922194061 1:223344674-223344696 GTGGAAAACATGAGAAGTGGTGG - Intronic
923052114 1:230396254-230396276 GGGGTAAAAAGGAGGAGTGTGGG - Intronic
923262174 1:232277817-232277839 GTAGTAAAAATCAGCACTGTAGG - Intergenic
923939590 1:238806770-238806792 GTGATGAAAAAGAGAATGGTAGG + Intergenic
924127873 1:240874703-240874725 GTGGTAAGAATGTGAAGTGACGG - Intronic
1063308440 10:4929929-4929951 GTAATAAAAATGAGGACTGTAGG + Intronic
1063318233 10:5027553-5027575 GTAATAAAAATGAGGACTGTAGG - Intronic
1063684457 10:8223313-8223335 TTGGTAAAAGTGAGAAATTTAGG + Intergenic
1064669861 10:17701704-17701726 GGGGTAAAAACGAAAATGGTAGG - Intronic
1064708164 10:18094417-18094439 CTGCTACAAATGAGAATTTTTGG - Intergenic
1064798944 10:19046731-19046753 GTGCTAAGAATGAGTATTGAGGG + Intergenic
1065040455 10:21689042-21689064 ATGTTAAAAATGAGGTTTGTAGG - Intronic
1066520205 10:36209358-36209380 GTTGTAAAAATGAAAATGTTAGG - Intergenic
1067988115 10:51175745-51175767 CTGGTACAAATGAAAATTATCGG + Intronic
1068451733 10:57198143-57198165 TTGTTAAAACTGAGAATTCTGGG + Intergenic
1068624611 10:59228353-59228375 GTGGTAACATTGAACATTGTTGG - Intronic
1068640544 10:59400411-59400433 GTGTCAAAAATCAGAGTTGTAGG + Intergenic
1068643733 10:59441385-59441407 GTGGTGAAAATGAGCATCTTTGG - Intergenic
1072430179 10:95364283-95364305 GTGATATAAATAAGAATTCTTGG + Intronic
1072822270 10:98569791-98569813 GAGGTAAAAAAGAGACTTCTGGG - Intronic
1073270529 10:102259117-102259139 CTAGTAATAATGAGAATAGTAGG + Intronic
1074469737 10:113715950-113715972 GTGGTTAAAATGAGAGTTGGTGG - Intronic
1074904750 10:117851897-117851919 GTGGTGAAAATGTGGATTCTAGG + Intergenic
1075298419 10:121298524-121298546 GTGGAACTGATGAGAATTGTAGG - Intergenic
1077605764 11:3610504-3610526 GTGGTAGAACAGATAATTGTTGG + Intergenic
1077629061 11:3798267-3798289 CTGGTACAAATGAGGATTGTTGG + Intronic
1078969123 11:16386201-16386223 GGGATAATAATGAGAATTGAAGG + Intronic
1080080280 11:28208897-28208919 ATTGTAAAAATGAGAGTTGATGG + Intronic
1080426249 11:32157380-32157402 GTGGAAAAATTCAGAATTGCTGG - Intergenic
1080762897 11:35269689-35269711 GTGGTAAAAAGAAAAAATGTGGG - Intronic
1082160346 11:48882796-48882818 ATGGCAAAAATGAGAAGTGCTGG - Intergenic
1082162020 11:48897610-48897632 ATGGCAAAAATGAGAAGTGCTGG + Intergenic
1082235944 11:49820595-49820617 ATGGCAAAAATGAGAAGTGCTGG - Intergenic
1082239403 11:49855151-49855173 ATGGCAAAAATGAGAAGTGCTGG - Intergenic
1082609453 11:55280523-55280545 ATGGCAAAAATGAGAAGTGCTGG - Intergenic
1082657238 11:55870010-55870032 ATGGCAAAAATGAGAAGTGCTGG + Intergenic
1083135001 11:60664570-60664592 GTGCTAAAAATGATAATTGGTGG - Intergenic
1083345652 11:61989258-61989280 GTGGTAAAACTAAGGATTGAAGG + Intergenic
1086738490 11:90337650-90337672 GAGAAAAAAATAAGAATTGTGGG + Intergenic
1087693300 11:101347029-101347051 ATGTTAACAATGAGAAGTGTAGG + Intergenic
1088090149 11:106028430-106028452 ATGGTAAAAATAGGAAATGTTGG + Intergenic
1088198568 11:107304450-107304472 GTGAGATAAATGTGAATTGTGGG + Intergenic
1088376064 11:109142932-109142954 GCAGGAAAAATGAGAAATGTTGG + Intergenic
1089070300 11:115694891-115694913 GTTTTAAAAATTAGAAATGTCGG + Intergenic
1090116009 11:123974680-123974702 GTTGAAAAAAAGAGAATAGTTGG + Intergenic
1090318172 11:125816504-125816526 CTGGTAATAAAGAGAATTCTGGG - Intergenic
1091105219 11:132912657-132912679 ATGATAAATTTGAGAATTGTTGG - Intronic
1091215449 11:133898701-133898723 GTGTTAGAAAGGGGAATTGTTGG - Intergenic
1092387344 12:8045957-8045979 GTGTTAAAAATAAGAAATATGGG - Intronic
1093365329 12:18288788-18288810 GTTTTAAAAAAGAGAATTGCTGG - Intronic
1094555871 12:31499090-31499112 GTGTTTAAAATGAGAAGTATAGG - Intronic
1094792022 12:33926466-33926488 TTGTTAAAAATGAAAATTCTAGG - Intergenic
1095771574 12:45965403-45965425 AAGGTAAAAATGAGAAAAGTGGG + Intronic
1097613677 12:61858378-61858400 TTAGTACAAATGAGAATTTTGGG - Intronic
1098233496 12:68396459-68396481 TTGCTAAAAATGAGGATTATAGG + Intergenic
1098326958 12:69312872-69312894 GTGGTGAAAATGAGAATAGGAGG + Intergenic
1098633665 12:72755271-72755293 ATGCAAAAAATGAGAATTTTTGG - Intergenic
1099898213 12:88675490-88675512 GTGGTTAAAATTAGTGTTGTAGG - Intergenic
1100357984 12:93849891-93849913 GGGGCAGAAATGAGAATCGTGGG - Intronic
1101061188 12:100974134-100974156 ATGTTAAAAATGAAAATTCTTGG - Intronic
1101615385 12:106331357-106331379 GTGGTTAAAATGAGCTTTTTTGG - Intronic
1102941595 12:116947346-116947368 GTGTTAACAAGGAGAATTCTAGG + Intronic
1106744982 13:32692579-32692601 TTGGTAACAAGGAGATTTGTGGG + Intronic
1106773888 13:32990197-32990219 GGGGTACAAATGAAAATTTTGGG - Intergenic
1107150027 13:37100285-37100307 GAGGTAAAGATGAGATTTGTAGG + Intergenic
1107256829 13:38437483-38437505 GTGTGCAAATTGAGAATTGTTGG + Intergenic
1107417273 13:40212279-40212301 GTGGTCCTAATGAGAAATGTTGG - Intergenic
1107866820 13:44711078-44711100 GTGGAAAGAATGAGAGTTCTGGG - Intergenic
1108240527 13:48458543-48458565 ATTGTAGAAATGAGAATTCTGGG + Intronic
1108318206 13:49259370-49259392 GTGAAAAACATGAAAATTGTTGG + Exonic
1108683253 13:52797535-52797557 CTGGTAAAGATGAGAAATGTGGG + Intergenic
1109282152 13:60369312-60369334 GTGGTAACACTGAGAATTGCAGG - Intergenic
1111167915 13:84486889-84486911 GTGGGAAAAATGGGAATGCTGGG - Intergenic
1111378161 13:87408594-87408616 GAGGTAAAAATCATAATTTTTGG + Intergenic
1113984561 13:114303483-114303505 CTGGTAAGAAGCAGAATTGTCGG + Intronic
1116127820 14:40811817-40811839 GTAGTAAGAGTGAGAATTGGAGG + Intergenic
1117759026 14:59006627-59006649 GTTGTAAAAAAGAAAAGTGTTGG + Intergenic
1118091584 14:62486488-62486510 GTGAGAAAAATGAGATTTATGGG - Intergenic
1119040403 14:71269521-71269543 GTGGTGAAGAAGAGAAATGTGGG + Intergenic
1121655176 14:95589740-95589762 TTGGTAAACATGACAAATGTAGG + Intergenic
1121872885 14:97425769-97425791 GTGGGAAAGATGAGAGTTATGGG + Intergenic
1123219540 14:106843190-106843212 GTGGTAAATATGTCATTTGTAGG - Intergenic
1126047887 15:44660826-44660848 GTGGTAAAAAACAAAAATGTGGG + Intronic
1126315866 15:47368712-47368734 TTTGTAAAAATGGAAATTGTAGG - Intronic
1126325802 15:47475997-47476019 GTGAAAACAAAGAGAATTGTTGG + Intronic
1127403251 15:58613061-58613083 ATGGGAAAAATGAGAATAGGAGG + Intronic
1127711951 15:61607690-61607712 AAGGTAAAAATGACAATTGCTGG - Intergenic
1128535757 15:68489002-68489024 GGGGTAGCAAGGAGAATTGTTGG + Intergenic
1129824487 15:78625639-78625661 GGGGTAAAAATGAGAAGTTGGGG - Intronic
1129938326 15:79470351-79470373 GTGATAAAGAGGAGAATAGTGGG - Exonic
1130804371 15:87303421-87303443 GGGGTAAAAATGATCTTTGTGGG - Intergenic
1133727510 16:8551152-8551174 CTGGTAAAAACCAGAATTCTAGG - Intergenic
1136001875 16:27300812-27300834 GTGGTAGAAATGAGATGGGTGGG - Intergenic
1136158176 16:28399671-28399693 GTCCTAAAGATGAGAATTGAAGG - Intronic
1136204911 16:28715612-28715634 GTCCTAAAGATGAGAATTGAAGG + Intronic
1138639241 16:58369841-58369863 GTGGTAAGAATGAGAACAGTAGG + Intronic
1139295819 16:65899731-65899753 TTGGTAAAAATGGAAATTCTTGG - Intergenic
1140836902 16:78803140-78803162 GTGGAATAAATCAGAACTGTTGG - Intronic
1141816511 16:86413887-86413909 ATGGTAAATATGTGAATTTTTGG - Intergenic
1145053388 17:19681537-19681559 GTGGTCAGAATGAGAATCATGGG - Exonic
1146073863 17:29709733-29709755 GTGGGGAAAATGAGAAGAGTTGG - Intronic
1146519355 17:33514426-33514448 CTGGTAAAATTGAGAAATTTGGG + Intronic
1149765969 17:59278618-59278640 GTGGTAAAGATGATGAATGTGGG + Intergenic
1150673709 17:67225364-67225386 GTGGTAAAAGTAGGAGTTGTCGG - Intronic
1151095115 17:71488581-71488603 GTAATAAAAATTAGAATTATTGG + Intergenic
1155240560 18:23860171-23860193 GAAGTAAAAATGAGAAGTGAGGG - Intronic
1155972491 18:32094306-32094328 GGGGAAAAAATGAGAAGAGTTGG - Intronic
1156804451 18:41160776-41160798 GTTTTGAAAATGAGACTTGTAGG - Intergenic
1157280411 18:46343365-46343387 ATGGGAAAACTGAGAATTGATGG - Intronic
1158249848 18:55475614-55475636 GTGGTACAAGTGAGACTTGAGGG - Intronic
1158755902 18:60325041-60325063 GTGGTGAAAATGAGCATCGTTGG - Intergenic
1159739962 18:72155203-72155225 CTGTTATAAATGAGACTTGTGGG + Intergenic
1159995148 18:74957244-74957266 ATGGTAGAACTGACAATTGTAGG - Intronic
1164813932 19:31179709-31179731 GTGGTAACAATGATGATGGTAGG + Intergenic
925068232 2:946754-946776 GTGGTAAGAATGAAACTTCTAGG + Intergenic
926868249 2:17383870-17383892 GTGGTAAGAATGCCAACTGTCGG + Intergenic
927742581 2:25585169-25585191 TAGAGAAAAATGAGAATTGTGGG - Intronic
928294360 2:30069962-30069984 GTGGTAAAGAGCAGATTTGTGGG + Intergenic
932065923 2:68559923-68559945 ATAGTAAAAATGAAAATAGTAGG - Intronic
933072513 2:77877933-77877955 GTGGCCAAAATGAAAATTTTGGG + Intergenic
933437391 2:82264973-82264995 GTAATAAAATTGAGAATTATTGG + Intergenic
936905932 2:117535895-117535917 GTGGGAAAAATAAGAATAGAAGG - Intergenic
937035994 2:118782463-118782485 GTGGTAATAATGACGATAGTAGG - Intergenic
937865415 2:126747888-126747910 GAGATAACAATGAGAATTGATGG + Intergenic
939453799 2:142406830-142406852 GTGCTAAACAGGAGAATTGATGG + Intergenic
941832521 2:169978170-169978192 GTGGAGAAAATGAGAATAGGCGG - Intronic
942757905 2:179363840-179363862 GTGGAAGAAAGGAGAATGGTTGG - Intergenic
942951331 2:181725439-181725461 GTGTTAAAAAGGAAAATTTTTGG - Intergenic
943459032 2:188146600-188146622 GTTGTAAAAGGGAGAATTGCAGG + Intergenic
944294792 2:198049920-198049942 CTAGTAAATATGAGAATTGATGG + Intronic
944586388 2:201177468-201177490 GTGGTTAAATTGAGTAATGTAGG - Intergenic
945187089 2:207150035-207150057 TGGGTAAAACTGAGAATTCTGGG - Intronic
948972712 2:241441668-241441690 CTTGTAAAAATGACAATGGTGGG + Intronic
948999689 2:241606122-241606144 GTGGTAAAAATGATACTTTCTGG - Intronic
1169024851 20:2361454-2361476 GTGGAAAAAATAAGCATTGTGGG - Intergenic
1170328547 20:15183030-15183052 GTGGTGGAAATGAGAATGGGAGG - Intronic
1172431011 20:34891807-34891829 GTGGTGAAAATGAGACAAGTAGG + Intronic
1172542290 20:35728085-35728107 CTCTTAAAAATAAGAATTGTAGG - Intronic
1174602681 20:51737605-51737627 GAGTGAAAAAAGAGAATTGTTGG + Intronic
1177319848 21:19507853-19507875 GTGGTGAATATGAGAATAGAAGG - Intergenic
1178107596 21:29337639-29337661 GTTGTAAAAATGAGAACACTTGG + Intronic
1178203343 21:30434192-30434214 GTGGGAAATTTGAGAATTGCTGG - Intergenic
1178494154 21:33072590-33072612 GTGGGAAATATGAGGATTATAGG + Intergenic
1179463545 21:41554617-41554639 GTGTTAAAAATAAGCCTTGTTGG - Intergenic
1181966487 22:26659535-26659557 GCATTAAAAATGAGAATTTTGGG + Intergenic
1182092197 22:27603455-27603477 GTGGAAAAAATGAAAAATGCTGG + Intergenic
1182218997 22:28742836-28742858 GAGGGAAAAGTGAGAATTGGAGG + Intronic
951854684 3:27181902-27181924 GGGGTAAAAATAAAAATTGTAGG + Intronic
952214498 3:31263770-31263792 GAGGTAAAAATGAAAATTTGAGG - Intergenic
955094061 3:55779815-55779837 GTGGTACACATCAGAATCGTGGG + Intronic
955832753 3:63021928-63021950 CTGTTAAAAATGAGATTTTTAGG + Intergenic
957635909 3:82784704-82784726 TTGGAAAAAATGAAAATTGGGGG - Intergenic
957892740 3:86380910-86380932 GTGGCAAAAATCAGAATGTTTGG - Intergenic
960050743 3:113237198-113237220 GTGGTAAAGATTAAAAGTGTTGG + Intronic
960237056 3:115295757-115295779 GTGGCAAAAAGGAGTTTTGTGGG + Intergenic
960308386 3:116090467-116090489 GTGGAGTAAATGAGAATTCTCGG + Intronic
960504211 3:118473193-118473215 GTGGTCAGAATTAGAATTGTTGG - Intergenic
960657746 3:120024684-120024706 GAGGTACAAAAGAGAATGGTGGG + Intronic
962179372 3:133189507-133189529 GTGGTAGAAGAGAGAATTCTAGG + Intronic
962183156 3:133229853-133229875 GTGGTGAAAATGTGACTTCTTGG + Intronic
962757147 3:138473750-138473772 GGGGGAAAAATGAGATTTGAAGG + Intronic
963946957 3:151156203-151156225 GTGGTAAAAGTCAGAAATCTTGG - Exonic
964666041 3:159173568-159173590 GTGGAAATAATGACATTTGTAGG - Intronic
965281210 3:166755375-166755397 GGTGTAAAAATAAGAATTTTAGG + Intergenic
966391076 3:179452735-179452757 TTAGTAAAAATGAAAATTTTGGG - Intergenic
966669934 3:182515536-182515558 GTGGTAAAGCTGAGAGATGTGGG + Intergenic
967775213 3:193379172-193379194 GGGGTGACAATGAGAATTGAAGG + Intergenic
968875166 4:3262909-3262931 GGGGTAAATATGACATTTGTGGG - Intronic
969171072 4:5364162-5364184 GTGGGAAAAGTGAGAATTAAGGG - Intronic
970887424 4:21002623-21002645 GTGTTAAAAATGCAAATTCTCGG + Intronic
970967353 4:21943845-21943867 GTGGTAGAAATGGAAATTGAAGG + Intronic
971738528 4:30490199-30490221 GTGTTAAAATTGAGAAAAGTTGG - Intergenic
971820459 4:31547081-31547103 ATTGTAAAAATGGGAATTGCAGG - Intergenic
972265063 4:37452270-37452292 GTAGTAAAAATGCAAATTCTTGG - Intergenic
973728926 4:53804536-53804558 GGTGTAAAGATGAGAATGGTGGG - Intronic
974556241 4:63452315-63452337 GTGGTAAAAATGTGCTTTGTTGG + Intergenic
975233758 4:71966549-71966571 GAGGTAAAAATAAAAACTGTAGG - Intergenic
975637645 4:76466102-76466124 GTGTCAAAAATGAAAAATGTAGG + Intronic
975810036 4:78158206-78158228 CTGCTAAAAATGATAATTGGTGG + Intronic
977225108 4:94385364-94385386 CTGGGAAAAATGGTAATTGTGGG + Intergenic
977877673 4:102168068-102168090 GTGATACAAATGAGAATATTGGG - Intergenic
978550726 4:109923293-109923315 GAGGTAAAATTAAGAAGTGTTGG - Intronic
979436802 4:120702925-120702947 GAAGTAAAAAAGAGAATTGGAGG - Intronic
980181938 4:129412043-129412065 CTGATTAAAGTGAGAATTGTAGG + Intergenic
980569071 4:134586778-134586800 GTGTTAAAAATGTAAATTGTGGG - Intergenic
980722237 4:136713858-136713880 GAAGTAAAAATGAGAAAAGTGGG + Intergenic
980863649 4:138529245-138529267 GTGGTGGAAATGTGAACTGTTGG - Intergenic
982732269 4:158968998-158969020 GAGGTAATAAGGAGAATCGTGGG - Intronic
982762307 4:159300462-159300484 GTGATAAAAATGAAAAATATAGG + Intronic
983762475 4:171428681-171428703 TTCGTTAAAATAAGAATTGTAGG + Intergenic
983923068 4:173368495-173368517 GTGGTAAAAATGAGAATATATGG - Intergenic
985934633 5:3087408-3087430 GTGATAACAATAATAATTGTTGG + Intergenic
986412011 5:7490044-7490066 GTGGTAAAAATTATCATTCTTGG + Intronic
987684116 5:21174354-21174376 CTGTTAAAAATGGGAAGTGTTGG - Intergenic
989185615 5:38622580-38622602 ATGGAAAAAATGAGAATTACGGG - Intergenic
989995670 5:50827280-50827302 ATGGCAAAAATGAGATTTTTAGG - Intronic
990105470 5:52253435-52253457 GTGGAAAAAATAAGAATCTTTGG - Intergenic
990203045 5:53399184-53399206 GTGGTCAGAAGGAGAATTGAGGG + Intergenic
991284407 5:64955503-64955525 GTGGTAATGCTGTGAATTGTAGG - Intronic
992257967 5:74941016-74941038 GTGGTAAATTTGAGATATGTAGG + Intergenic
992308498 5:75468380-75468402 GAGGAAAAAAAGAGAAGTGTAGG + Intronic
993665678 5:90692812-90692834 GTGGGAGTGATGAGAATTGTGGG + Intronic
994236193 5:97365747-97365769 GTGGTAGCAGTGAGAAGTGTGGG + Intergenic
995599364 5:113778989-113779011 GTGTGAAAAATGTGAATTATGGG - Intergenic
996322643 5:122236254-122236276 GTGTTTAAAAGGAGAATTTTGGG - Intergenic
996566920 5:124890213-124890235 GTAGTAGAAATGAAACTTGTGGG + Intergenic
996881941 5:128308293-128308315 GTTTTAAAGTTGAGAATTGTAGG + Intronic
997160546 5:131604756-131604778 TTGCTTAAAATCAGAATTGTGGG - Intronic
997366699 5:133330207-133330229 GTGATAAAAAGGAGAAATGCAGG - Intronic
997438971 5:133895734-133895756 ATGGAAAAAATGAGTATTGATGG - Intergenic
998419233 5:141968881-141968903 TTGGTAAAAATTCGAATTCTCGG + Intronic
998620946 5:143793678-143793700 GTGGAAATAAAGACAATTGTAGG - Intergenic
998792791 5:145783510-145783532 CTGTTAAAAATCAGAATTCTTGG + Intronic
999510809 5:152249680-152249702 GTGATAAAAATGACAATACTTGG + Intergenic
999819879 5:155216055-155216077 GTGGTAGCAATGAGATTTGGAGG + Intergenic
999983153 5:156977114-156977136 GTGGAAGAAATGACCATTGTTGG + Intergenic
1002969903 6:2004755-2004777 GTGATCAAAATAAGGATTGTGGG + Intronic
1003036124 6:2641842-2641864 GTGGTAGGAATGACAAGTGTGGG + Intergenic
1004362063 6:14979902-14979924 GTTATAAGAATGTGAATTGTGGG - Intergenic
1004440681 6:15649505-15649527 GGAGTAGAAATGAGAGTTGTTGG + Intronic
1006740668 6:36306152-36306174 GTTGTAAAGATGAGAATTTGAGG + Intronic
1008204094 6:48631745-48631767 GGGGTAAAAATGAGAGTACTGGG + Intergenic
1008579791 6:52896539-52896561 TTAGTAAAAATGGGAAATGTAGG - Intronic
1009568322 6:65344760-65344782 ATGGTAAATCTCAGAATTGTAGG + Intronic
1010304336 6:74301338-74301360 GGGGAAAAAATTAGAAATGTGGG + Intergenic
1010703078 6:79076564-79076586 GTTGTCAAAATGAGTATTTTAGG - Intronic
1010727793 6:79354846-79354868 GTTTTAAAAATGAGAAGTGAGGG - Intergenic
1010805109 6:80226507-80226529 CTGGTGAAAATGAAAATGGTAGG + Intronic
1011102433 6:83737850-83737872 GTGCTAAAAATGAAAATAATTGG - Intergenic
1011827715 6:91330259-91330281 GTGCTAAAATTCAGAAATGTTGG - Intergenic
1011934039 6:92753290-92753312 GTGGAGAAAATGAGAATAGTAGG - Intergenic
1013346543 6:109265885-109265907 GTGCTAAAATTGAGAAATCTTGG - Intergenic
1013996960 6:116320336-116320358 TTGGTAAAAATGAGATTTTCTGG + Intronic
1014853746 6:126373779-126373801 GTGGTAAAAGTGGGTATTTTGGG - Intergenic
1017972764 6:159327412-159327434 GTGGGAAAACTGAGACTGGTGGG - Intergenic
1018233763 6:161702680-161702702 GTGGTTAAAATGGTAATTTTAGG + Intronic
1018545132 6:164927558-164927580 GCGGTAAAAGGGAGAAATGTTGG + Intergenic
1018550933 6:164997986-164998008 ATGGTTAAAAAGAGAAGTGTTGG + Intergenic
1020121863 7:5508853-5508875 GTGGTAAGAATGAGAACTTAGGG + Intronic
1021723658 7:23529932-23529954 GAGGGAAAAGTGACAATTGTCGG + Intronic
1022216307 7:28265628-28265650 TTGGTAAAAATGCAAATTTTGGG - Intergenic
1023707103 7:42952521-42952543 GTGTTAAAAATGATAACTGTAGG - Intergenic
1023887407 7:44368842-44368864 GGGGAAAAAATGAGAATAGGAGG + Intergenic
1024597241 7:50948288-50948310 GTGGGAAAAATAAGAATAGGAGG + Intergenic
1024778055 7:52811475-52811497 GTGGTAATATTTAGAATTGAAGG - Intergenic
1025059402 7:55791689-55791711 GTGTTAAAAATGTGTATTTTGGG + Intergenic
1027949779 7:84800334-84800356 TTGGTAAAAATTAGAATTCCTGG + Intergenic
1028635501 7:92984731-92984753 GTGTTAAAACTGAGATTTCTGGG + Intergenic
1030123117 7:106129986-106130008 CTGCCAAAAATGAGAATTGCTGG - Intergenic
1030748842 7:113204268-113204290 ATGTTAAAAAGGAGAATAGTAGG + Intergenic
1031880240 7:127189658-127189680 GAGGTAAAACTGATAACTGTGGG + Intronic
1033204645 7:139407948-139407970 GTGGTAAAGATGAGTGTTGGTGG + Intronic
1033236100 7:139638954-139638976 GTGTCAAAAATGACAATTATTGG - Intronic
1034272310 7:149809193-149809215 TTGGTAAGAATGAGAACTGGAGG - Intergenic
1037120011 8:15272474-15272496 GTGATCAAAATGTGAAGTGTTGG + Intergenic
1039656158 8:39410387-39410409 GTGGTGATAATGGGAACTGTTGG + Intergenic
1040891535 8:52322242-52322264 GTGGTAAAAATGAGAATTGTAGG - Intronic
1042797977 8:72685500-72685522 GTGTTAAAAATGAGGAGTGATGG + Intronic
1043251735 8:78083375-78083397 GTGGGTAAAATGAGAAATGTTGG + Intergenic
1045253023 8:100496998-100497020 GAGGTATAAATGAAAATTATTGG + Intergenic
1045584651 8:103519525-103519547 GAGAAATAAATGAGAATTGTGGG - Intronic
1045962793 8:107988598-107988620 TTGGAAAAAATGAGTATGGTAGG - Intronic
1046397103 8:113655349-113655371 ATGGTAAAAATTATAATTGTTGG + Intergenic
1050307207 9:4316838-4316860 GTGTTTAATATGAGAAGTGTTGG + Intronic
1050495147 9:6232843-6232865 GTGGTCAGAATGAGATTTTTTGG - Intronic
1050600402 9:7244607-7244629 GGCATAAAAGTGAGAATTGTTGG + Intergenic
1051155244 9:14135994-14136016 GTGATAAAATTGAGACTTGTAGG - Intronic
1051391401 9:16568440-16568462 GTGGTATAATTGAAAATTATTGG - Intronic
1053341304 9:37336536-37336558 ATGGTAAAAATGAAAATCTTGGG + Intronic
1053426406 9:38013133-38013155 TTCTTAAAAATAAGAATTGTGGG + Intronic
1058371878 9:104278389-104278411 ATGGTAAAAATGAGCATTTATGG + Intergenic
1058625957 9:106932761-106932783 ATTTTAAAAATGAGAATTGGAGG + Intronic
1059040433 9:110808919-110808941 GTGATTAAAATTAGAAGTGTTGG + Intergenic
1060209994 9:121704150-121704172 TTGGGAAAAATCAGAAATGTAGG - Intronic
1186458940 X:9733093-9733115 GTGGGAAAGATGGGGATTGTGGG + Intronic
1186458989 X:9733424-9733446 GTGGGAAAGATGGGGATTGTGGG + Intronic
1186642128 X:11467080-11467102 GTGGACAAAATGCGAATTCTAGG + Intronic
1186720388 X:12297502-12297524 GTGGGAAAAAACAGAATTGTGGG + Intronic
1186847836 X:13548721-13548743 GTGAGAGAAAAGAGAATTGTGGG - Intergenic
1188057527 X:25558706-25558728 GTGGTAAAATTGAAAACTTTAGG - Intergenic
1188230898 X:27661210-27661232 GTGGTAGAAATGTGGATTGCTGG + Intronic
1189550417 X:42086989-42087011 GTGGTCAAGATGGGAGTTGTTGG - Intergenic
1191081657 X:56517765-56517787 GTTGTCAAAATGAGAGTTATGGG + Intergenic
1192078412 X:68023652-68023674 GGGATATAAATGAGAATTCTTGG + Intergenic
1193249613 X:79273960-79273982 TTGGAAAAAATGAATATTGTAGG + Intergenic
1194758373 X:97764386-97764408 GTGACAAAAAGGAGATTTGTTGG + Intergenic
1195332235 X:103812560-103812582 GTTGTTAAAATCAGAGTTGTTGG - Intergenic
1197631220 X:128861462-128861484 GAGATAAGAGTGAGAATTGTGGG - Intergenic
1201012228 Y:9558141-9558163 GTAGTAAAAATGAAAAATTTAGG - Intergenic
1201651498 Y:16293592-16293614 ATGGTAAAAAAAAGATTTGTAGG + Intergenic