ID: 1040892018

View in Genome Browser
Species Human (GRCh38)
Location 8:52326999-52327021
Sequence CTGTGGGGCTCCCTCTCCGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 204
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 188}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040892018_1040892023 -6 Left 1040892018 8:52326999-52327021 CCACCGGAGAGGGAGCCCCACAG 0: 1
1: 0
2: 1
3: 14
4: 188
Right 1040892023 8:52327016-52327038 CCACAGCCTTCATTTAAGCTTGG No data
1040892018_1040892025 10 Left 1040892018 8:52326999-52327021 CCACCGGAGAGGGAGCCCCACAG 0: 1
1: 0
2: 1
3: 14
4: 188
Right 1040892025 8:52327032-52327054 AGCTTGGTTTTGTTGTTACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040892018 Original CRISPR CTGTGGGGCTCCCTCTCCGG TGG (reversed) Intronic
900090112 1:916568-916590 CTCTGGGGCTCCCACACCTGGGG + Intergenic
900365510 1:2310534-2310556 CTGTGGGGCTTCCTCCCAGCCGG - Intergenic
900713256 1:4128364-4128386 CTGTGTGTCTCCCTCTCTGTGGG + Intergenic
900997428 1:6130071-6130093 CTGTGGGCCTCCCTCCCCCGTGG - Intronic
902171843 1:14617987-14618009 CAGCGGGGCTCCCTCTCCCAGGG - Intronic
902436011 1:16398427-16398449 TTGTGGGGCTCCCAGTCCAGAGG + Intronic
903000277 1:20260551-20260573 CTGTGGAGTTCCCTCTTCTGTGG - Intergenic
903029529 1:20452939-20452961 CTGTGGGGCTCCTTCTGTGGAGG - Intergenic
906010993 1:42526015-42526037 CTGTGTGGCTCCCTTTTCTGTGG + Intronic
907069208 1:51519009-51519031 CAGGGGGGCTCCGGCTCCGGAGG + Intronic
912392401 1:109313095-109313117 CTGTGAGGTTCCGTCTTCGGGGG + Exonic
915106057 1:153535818-153535840 CTGTGGCGCTCCCCCGCTGGAGG - Exonic
915354935 1:155250435-155250457 CTGGGCGGCCCCCTCCCCGGGGG + Exonic
915363577 1:155300902-155300924 CTCTGGGTCTCCCTCTCTGTGGG + Intronic
915457604 1:156051149-156051171 TGGTGGGGGGCCCTCTCCGGGGG - Exonic
915497749 1:156293542-156293564 CTGTGGGGCTCCCTCCCATCAGG - Exonic
919796730 1:201325453-201325475 CTGTGGGGCTCTCTCTTCCCCGG + Intronic
923035300 1:230281175-230281197 CTGTGTGTCTTCCTCCCCGGCGG + Exonic
1062834923 10:629259-629281 CTGTGAGGATCCCTCTCCTGAGG + Intronic
1063139200 10:3241424-3241446 CAGTTGGGCTCCCGCTCCAGGGG + Intergenic
1064271555 10:13870622-13870644 CTGTGGACCTGCCTCTCAGGAGG - Intronic
1064732372 10:18346071-18346093 CTGCAGGGCTCCCCCTCCAGTGG + Intronic
1067081299 10:43214032-43214054 CTGTGTGGCTGCCCCTCCCGAGG - Intronic
1068851831 10:61751119-61751141 CTGTGCTGCTCCCTCTGCTGGGG - Intronic
1073242076 10:102065617-102065639 CTGTGGGGCTACCGCCCCAGGGG - Exonic
1073470786 10:103720899-103720921 CTGAGGGGCTCCCCCTCCCCGGG - Intronic
1074305965 10:112278775-112278797 CTGTGGGTCCCCCTCTTCTGAGG + Intergenic
1075689153 10:124384163-124384185 CTGTTGGGCTAGCTCTCCGGTGG + Intergenic
1076163360 10:128263110-128263132 ATCTGGGGCTCCCTGTCTGGGGG - Intergenic
1076228865 10:128803375-128803397 CTCTGGGTCTTCCTCTCCAGAGG - Intergenic
1077218510 11:1405030-1405052 GTGTGGGCCTCCATCTCTGGTGG + Intronic
1079946821 11:26753716-26753738 CTGTGTGGCTGCCTCTACCGGGG + Intergenic
1080682180 11:34487221-34487243 CTCTGGGGCTGGCTCTCAGGTGG + Intronic
1081570377 11:44286942-44286964 CTGTGCGCCACCCTCTCTGGAGG - Intronic
1083895225 11:65616348-65616370 GTGTGGGCCTCGCTCACCGGCGG + Exonic
1083900448 11:65640896-65640918 CTGTGGGCCTGACTCTCCGGGGG - Exonic
1084667223 11:70582953-70582975 CTGTGCAGCTCACTCTCCTGAGG + Intronic
1084720486 11:70902486-70902508 CTTGGGGGCTGCCTCTCAGGGGG + Intronic
1085769025 11:79308768-79308790 CTGTGGGTCTCGCACTCAGGAGG - Intronic
1091239032 11:134040171-134040193 CTCTGGGGCTCCCGCTCCCTGGG - Intergenic
1092140106 12:6177994-6178016 CTGTCGGGCTCCCCCTCCCCTGG - Intergenic
1094858415 12:34431530-34431552 CTGTAGGGCTCCACCTCTGGGGG + Intergenic
1095401024 12:41814625-41814647 CTGTGGAGGTCCCACTCCAGGGG + Intergenic
1096257808 12:50073619-50073641 CCCTGGGGCTTCCTCTCCAGAGG - Intronic
1096670915 12:53197787-53197809 CTGGGTGGCACCCTCTCCGCGGG + Exonic
1100979827 12:100155274-100155296 CTTTGGGGCTCCCTGTTCAGTGG + Intergenic
1101168256 12:102061756-102061778 CTGTGGGGCTCTCCCTCCTGAGG + Intronic
1101877252 12:108603905-108603927 CTGCTGGTCTCCCTCTCCAGAGG - Intergenic
1101884214 12:108647949-108647971 CTGTGAGGCTCCTTCTTGGGAGG + Intronic
1103340277 12:120217193-120217215 CTTTTGTGCTCCCTCTCCTGAGG - Intronic
1105472020 13:20703580-20703602 CTCCGGGGCTCCCTCGCTGGCGG + Intronic
1110615461 13:77536747-77536769 CTGTGGGGGCACCTCTCTGGAGG - Intronic
1111618392 13:90691446-90691468 CTGTGGGGCTCCTGCACAGGTGG - Intergenic
1111919559 13:94396121-94396143 CCCTGGGGCCCCCTCTCCTGTGG + Intronic
1113848953 13:113407240-113407262 CTTTGGGGCTCCTCCTCCAGGGG + Intergenic
1119431733 14:74572770-74572792 GTGAGGGTCTCCCTCTGCGGGGG - Intronic
1122370599 14:101227051-101227073 CTGTGGGCCTGCCTCTCCCTGGG - Intergenic
1122605400 14:102944671-102944693 ATGTGGGGCAGCTTCTCCGGGGG - Intronic
1122612576 14:102995676-102995698 CTGTGGGGATCCCACCCCGCAGG - Intronic
1122625948 14:103085406-103085428 CAGTGGGGCTCCCCCTGCTGTGG + Intergenic
1122897633 14:104768422-104768444 CTATGGGGCACCCCCTCCAGTGG + Intronic
1126383503 15:48071304-48071326 CAGAGGAGCTCACTCTCCGGGGG + Intergenic
1128536334 15:68493439-68493461 CTTTTGGGCTCCCTCTCTGTAGG + Intergenic
1129557471 15:76527692-76527714 CTGTTGTGCTCCTTGTCCGGAGG - Intronic
1130725407 15:86433658-86433680 CTGAGGGGCACCCTCCCTGGAGG - Intronic
1133042689 16:3068878-3068900 CTGTGGGCCTCCGTCTCCCAGGG + Intronic
1133044732 16:3081521-3081543 CTGTGGGCCTCCGTCTCCCAGGG + Intronic
1136458556 16:30395837-30395859 CTCTGTGGCTCCCTCTCCTCCGG - Exonic
1140453367 16:75089515-75089537 CAGTGGTGCTTCCTCTCCAGAGG + Intronic
1142176596 16:88648139-88648161 CTGTGGGGCTCCCGTCCCGGGGG + Intronic
1142757074 17:2022912-2022934 CTGTGGGGGCCGCTCCCCGGGGG - Intronic
1143128932 17:4663835-4663857 CGGGGAGGCTCCCTCTCCAGCGG - Intergenic
1143375152 17:6462940-6462962 CTGTGGTCCTTCCTCTCTGGGGG - Intronic
1144090038 17:11847944-11847966 GTGTAGGGCTCCTTCTCCAGAGG + Intronic
1144875469 17:18394909-18394931 CTGTGGGGCTGACTCCCAGGAGG - Intergenic
1145156756 17:20549512-20549534 CTGTGGGGCTGACTCCCAGGAGG + Intergenic
1145798934 17:27671396-27671418 CTGTGGGGCTGACTCCCAGGAGG + Intergenic
1146160143 17:30555217-30555239 CTGTGGGGCTGACTCCCAGGAGG - Intergenic
1146844267 17:36173600-36173622 CTGTGGGGCTGACTCCCAGGAGG + Intronic
1146856572 17:36261535-36261557 CTGTGGGGCTGACTCCCAGGAGG + Intronic
1146864045 17:36326840-36326862 CTGTGGGGCTGACTCCCAGGAGG - Intronic
1146879840 17:36436531-36436553 CTGTGGGGCTGACTCCCAGGAGG + Intronic
1147066905 17:37927428-37927450 CTGTGGGGCTGACTCCCAGGAGG - Intronic
1147075366 17:37986070-37986092 CTGTGGGGCTGACTCCCAGGAGG + Intronic
1147078437 17:38006989-38007011 CTGTGGGGCTGACTCCCAGGAGG - Intronic
1147086891 17:38065616-38065638 CTGTGGGGCTGACTCCCAGGAGG + Intronic
1147094375 17:38130924-38130946 CTGTGGGGCTGACTCCCAGGAGG - Intergenic
1147102836 17:38189579-38189601 CTGTGGGGCTGACTCCCAGGAGG + Intergenic
1148445157 17:47733248-47733270 CTCTCGGGCTTCCTCTCCAGCGG - Exonic
1149647133 17:58249100-58249122 CTGTGGTGCTCCTGCTCCCGTGG + Exonic
1149847410 17:60016046-60016068 CTGTGGGGCTGACTCCCAGGAGG + Intergenic
1150085768 17:62272663-62272685 CTGTGGGGCTGACTCCCAGGAGG + Intronic
1151396990 17:73829829-73829851 CTGTAGGGCTCCCGCTCCTTTGG + Intergenic
1152297984 17:79479445-79479467 CTGAGGGGCTTCCTCTCAGAGGG + Intronic
1152934116 17:83126052-83126074 CTGTGGGGCTGTCACTCCTGAGG + Intergenic
1153219251 18:2847442-2847464 CCGGGCGGCTCCCTCTGCGGGGG + Intronic
1157394127 18:47327596-47327618 CTGGGTGGCTCCCTCCCAGGGGG - Intergenic
1160408817 18:78660842-78660864 CTGTGGGACTCCCGGTCCTGTGG - Intergenic
1161014879 19:1978593-1978615 CTGAGGGACGCCCTCTGCGGCGG - Exonic
1161963593 19:7535753-7535775 CAGTGCTGCTCCCTCCCCGGGGG - Intronic
1163013727 19:14441134-14441156 CTGCGAGGCTCACTCTGCGGAGG - Exonic
1163115824 19:15188205-15188227 TTTTCGGGCTCCCTCTCCTGAGG + Intronic
1163790374 19:19302714-19302736 CTGTTGGGCCTCCTCTCCTGGGG + Intronic
1164667964 19:30053870-30053892 CTGTGGGGCTTCGCCTCCCGTGG - Intergenic
1164682506 19:30145100-30145122 CTGAGGGGTGCCCTCGCCGGGGG + Intergenic
1165068312 19:33241433-33241455 CTCTAGGCCTCCCTCCCCGGGGG + Intergenic
1165803191 19:38565406-38565428 CTCTGGGGCTCGCTGTTCGGCGG + Exonic
1166790548 19:45396284-45396306 CTGTGGGGCTGCCTCTCCTCCGG + Intronic
1166961042 19:46495930-46495952 GTGTGCGGCTCCCTCTGCGCAGG - Exonic
1167055667 19:47110732-47110754 CTTCCGGGCCCCCTCTCCGGGGG - Intronic
1167648976 19:50719477-50719499 CTGAGGGTCCCCGTCTCCGGGGG - Intergenic
1168408006 19:56120821-56120843 CGGTGGGGGTCCCTCTGCTGCGG - Intronic
925059279 2:878630-878652 CTGTGACCCTCCCTCTCTGGAGG - Intergenic
928377429 2:30787111-30787133 GTGTGGGGCTCACTCACCTGTGG + Exonic
928742184 2:34368452-34368474 CTGCAGGGCTCCCTCCCCTGTGG + Intergenic
929202912 2:39256857-39256879 CTGTGGTTCTCCATCTCCTGTGG + Intronic
931957958 2:67449770-67449792 CTTTGGGTCTTCCTCTCTGGAGG + Intergenic
935590416 2:104842767-104842789 CTCTGGGGCGCGCTCACCGGAGG + Intergenic
937918549 2:127113693-127113715 CTTTGGAGCTCCTTCTTCGGTGG + Intergenic
938120664 2:128631086-128631108 GTGTGGGGCTGCCTCTGCTGGGG - Intergenic
944667296 2:201968524-201968546 CTGTGGGGCACCCTGTCCCCTGG + Intergenic
944808688 2:203307430-203307452 CTGTGGGGTTCTCCCTCCTGGGG - Intergenic
947344642 2:229178252-229178274 CTGTTGTGGTCCCTCTCCTGAGG - Intronic
947730962 2:232431463-232431485 CTGTGGGGTTCCCTCTCTTTAGG - Intergenic
947792931 2:232878046-232878068 CAGGGGGCCTCCCTCTCCGGTGG + Intronic
948765221 2:240215942-240215964 CTGTGTGGTTCCCTCCCCAGAGG - Intergenic
1168878159 20:1185268-1185290 CTGCGGGGGTCTCTCTCCTGCGG + Intronic
1169211859 20:3770265-3770287 CTCTGGGGCTTCCTGTGCGGAGG + Intergenic
1171413255 20:24960444-24960466 CAGTGGGGCGTCCTCTCTGGAGG - Intergenic
1171532394 20:25861321-25861343 CTGCGGTGCTCCCTCACCCGAGG - Intronic
1172191211 20:33063013-33063035 CTCTGAGGCTCCCACTCCAGTGG + Intronic
1173785735 20:45791797-45791819 CGTTGGGGCTTCCTCTCGGGAGG - Intronic
1174203058 20:48820460-48820482 CTGGGAGGCTCCCTCTCTTGCGG - Intronic
1174336475 20:49865103-49865125 CTGTGAGGCTCCCTCAGAGGAGG + Intronic
1176069668 20:63219505-63219527 CTGGAGGGCTCCCTCTCTGAGGG - Intergenic
1176309167 21:5140713-5140735 TTGTGGGGCTCCCGCTCTGTGGG - Intronic
1179355321 21:40653374-40653396 CTGTGGACCACCCTCTCCAGAGG - Intronic
1179847894 21:44121320-44121342 TTGTGGGGCTCCCGCTCTGTGGG + Intronic
1181018096 22:20082907-20082929 GTGTGGGCCTTCCTATCCGGTGG + Intronic
1184152242 22:42645955-42645977 CTGTGGTGCGCCCTCTCTGCCGG - Intronic
1184678952 22:46059458-46059480 CTGTGTGGTTCCCCCTCCAGAGG - Intronic
1185295857 22:50054414-50054436 CTCCTGGGCTCCCTCTCCTGGGG + Intronic
950495523 3:13331849-13331871 CTGTGCGGCCCCCTCGCCTGGGG + Intronic
964663920 3:159151512-159151534 CTGTGGAGCTGCCCCTCCTGTGG + Intronic
968084073 3:195866872-195866894 CTGTGGGGCTCACTCACTTGTGG + Exonic
968225293 3:196969033-196969055 CGCTCGGGCTCCCTCCCCGGCGG + Intronic
968625195 4:1623868-1623890 TTGATGGGCTCCCTCTCTGGCGG + Intronic
968880731 4:3297802-3297824 CTGTGGGGCTCCCTGTGCACTGG + Intronic
977310067 4:95374706-95374728 CCCTGGGCCTCCCTCTCCAGAGG - Intronic
978656130 4:111067693-111067715 CTGTGAGGCTCCATATCCCGGGG + Intergenic
979275787 4:118812916-118812938 CTGTGGGGCTCCGACTCCCATGG - Intronic
979597217 4:122547374-122547396 CTGTGGGGTCCCCTCCCTGGTGG + Intergenic
981015596 4:139970696-139970718 CTTAGGGGCTCACTCTCCTGAGG + Intronic
981039428 4:140209814-140209836 ATGAGGGGCTCCTTCTCCAGTGG - Intergenic
985558100 5:568012-568034 CTGAGGGGCTGCCTCTCTGAGGG + Intergenic
986079405 5:4374615-4374637 CTGTGAGGCTTCCTCTCCCTAGG + Intergenic
987347838 5:16994474-16994496 TTGTGGAGATCCCTCTCCTGAGG + Intergenic
990470743 5:56113007-56113029 CCCTGGGGCTCTCTCTCTGGTGG - Intronic
997606173 5:135177161-135177183 CTGGGGGGCTCCCTCCTAGGCGG - Intronic
1006386457 6:33733701-33733723 GTGTGGGCCTCCCTCTCCCTGGG - Intronic
1007594552 6:43043466-43043488 CTGTGAGGCACCCCCTCCTGTGG - Exonic
1011014110 6:82735967-82735989 CCATGGGGCTCACTCTCAGGAGG + Intergenic
1013424426 6:109998211-109998233 CTGTGGGACTCCATCTCAGAGGG + Intergenic
1015028219 6:128562932-128562954 CTGTGTGGCTCTCTCTCCTTTGG - Intergenic
1018876240 6:167825839-167825861 CGGTGGAGCGCCCTCTCCGAAGG - Intergenic
1019156143 6:170040018-170040040 CTGTGGGCCTCCATCACTGGGGG + Intergenic
1019412367 7:911902-911924 CTGTGGGGCTGCCCCTCGGGGGG - Intronic
1019525963 7:1480685-1480707 CTGTGGGGGCCCCTCTCAGGTGG + Intronic
1019562198 7:1664698-1664720 GTGTGGGGCTCCCCGGCCGGAGG + Intergenic
1023457324 7:40354491-40354513 CTTTGTGGCTCCCTCTCATGTGG - Intronic
1024338531 7:48234239-48234261 CTGTCTGGCTGCCTCTCCCGTGG - Intronic
1024561283 7:50647689-50647711 CTGTGATGCTCCCTCCCAGGCGG + Intronic
1024731049 7:52254287-52254309 CTCTGGGGCTCTCTCTGTGGGGG - Intergenic
1026025544 7:66741098-66741120 CTGGCCGCCTCCCTCTCCGGCGG + Intronic
1027185625 7:75968962-75968984 CCGTGGGGCTGTCTCTCCAGGGG + Intronic
1027616480 7:80430728-80430750 TAGGGGGGCTCCCTCTCCTGCGG - Intronic
1029576319 7:101405887-101405909 CTGTGGGGCTGGCTCTCAGGTGG + Intronic
1029709347 7:102291130-102291152 CAGTGGGGCTCCCTTTGCTGGGG + Intronic
1029903892 7:104071667-104071689 CTGTTGGGCTCCCACTTTGGCGG + Intergenic
1031393869 7:121248307-121248329 CTGTGGGGCTCCCTGAACAGAGG - Intronic
1035217388 7:157378416-157378438 CTGTGGGGCTCCAACTGGGGTGG - Intronic
1035530477 8:346856-346878 CTGTGGGTCTCCCTCACCACAGG + Intergenic
1036041562 8:5087951-5087973 CTGTGGAGCTCCCTCTTTGCTGG - Intergenic
1039597049 8:38799425-38799447 CTGTGGGGCTCCGAGTCTGGAGG + Intronic
1040110123 8:43563527-43563549 GTGTGCGTCTCCCTCACCGGGGG - Intergenic
1040892018 8:52326999-52327021 CTGTGGGGCTCCCTCTCCGGTGG - Intronic
1041279609 8:56197249-56197271 CTGTGTGTCTCCCTCTGCCGTGG + Intronic
1044589666 8:93901743-93901765 CTGTGGGGCTGCATCTGCTGTGG + Intronic
1048006004 8:130419744-130419766 CCCTGGGGCTCCCTCTCTAGGGG + Intronic
1048703072 8:137115993-137116015 CTGTGGTGGCCCCTCTCTGGGGG - Intergenic
1049337545 8:142094470-142094492 CTCCGGGGCTCCCGCTCCAGGGG - Intergenic
1049755874 8:144311106-144311128 CTGTGGGGCTCCCTCAGCCCTGG + Intronic
1056681079 9:88719739-88719761 CTGTTGGGCTCCCTTGCTGGTGG + Intergenic
1060991728 9:127853528-127853550 CTGTGGGGCTCCTTGGCCTGGGG - Intronic
1061062139 9:128255755-128255777 CTCTGGGGCTCCCTGTTCAGTGG + Intergenic
1186898619 X:14030077-14030099 CGGTGCAGCTCCCTCTCCGCCGG - Intergenic
1187547647 X:20268060-20268082 CTGTGGGGCTCCGTCGCCGTCGG - Intergenic
1188104876 X:26138085-26138107 CTGTGGGGGTCCCTCTTCTTGGG - Intergenic
1188245461 X:27831660-27831682 CTGTGGGACTCTCTATCCTGGGG - Intergenic
1192169654 X:68846439-68846461 CTCTGGGGGTCCCTCTCCTGTGG + Intergenic
1200303835 X:155005567-155005589 CTGATGGGCTCCCTTTCCTGGGG - Intronic
1200934763 Y:8728673-8728695 CTGTGGGGCTCTCTCTCAGGTGG - Intergenic
1202179523 Y:22127637-22127659 CTGTGGGGCTCTTTCCCAGGTGG - Intergenic
1202211838 Y:22458757-22458779 CTGTGGGGCTCTTTCCCAGGTGG + Intergenic