ID: 1040892653

View in Genome Browser
Species Human (GRCh38)
Location 8:52333780-52333802
Sequence GGCTCTCTTGCTACTGAAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040892651_1040892653 -10 Left 1040892651 8:52333767-52333789 CCCAGGAAAGTATGGCTCTCTTG 0: 1
1: 0
2: 0
3: 9
4: 162
Right 1040892653 8:52333780-52333802 GGCTCTCTTGCTACTGAAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040892653 Original CRISPR GGCTCTCTTGCTACTGAAAC TGG Intronic
No off target data available for this crispr