ID: 1040894869

View in Genome Browser
Species Human (GRCh38)
Location 8:52355378-52355400
Sequence TTTGGCTATGCTAGGGGTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 177
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 167}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040894869_1040894877 21 Left 1040894869 8:52355378-52355400 CCCCAACCCCTAGCATAGCCAAA 0: 1
1: 0
2: 0
3: 9
4: 167
Right 1040894877 8:52355422-52355444 TAGACAGAATGAGGACAAACAGG No data
1040894869_1040894876 12 Left 1040894869 8:52355378-52355400 CCCCAACCCCTAGCATAGCCAAA 0: 1
1: 0
2: 0
3: 9
4: 167
Right 1040894876 8:52355413-52355435 GCAAGAATGTAGACAGAATGAGG No data
1040894869_1040894878 25 Left 1040894869 8:52355378-52355400 CCCCAACCCCTAGCATAGCCAAA 0: 1
1: 0
2: 0
3: 9
4: 167
Right 1040894878 8:52355426-52355448 CAGAATGAGGACAAACAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040894869 Original CRISPR TTTGGCTATGCTAGGGGTTG GGG (reversed) Intronic
900615161 1:3562443-3562465 ATTGACTATGCGAGGGTTTGGGG - Intronic
900796776 1:4712721-4712743 TTTGGGTTTGCTTGGGGTTGAGG + Intronic
901313734 1:8290866-8290888 TTTGGTGATGCTGGGGGATGGGG + Intergenic
902974353 1:20078195-20078217 TTGGGCTATGCCAGGCTTTGGGG + Intronic
908211966 1:61909816-61909838 TTTGGCTATCCCAGTGGTGGGGG + Intronic
910803543 1:91167868-91167890 TTTGGGTATTCACGGGGTTGTGG - Intergenic
912891411 1:113536072-113536094 TTTGGCTATACATGGGATTGTGG - Intronic
915309520 1:155000267-155000289 TTTGGCGTGGTTAGGGGTTGGGG + Intergenic
915455302 1:156036518-156036540 ATTGGTTGGGCTAGGGGTTGGGG + Exonic
919878186 1:201885773-201885795 TTGGGCTTGGCTAGGGGCTGTGG - Intergenic
919909031 1:202098748-202098770 TTTGGCTATCCTGGGCGGTGGGG - Intergenic
920205836 1:204291232-204291254 TTTAGCTATTCTAGTGGGTGTGG - Intronic
922873232 1:228920055-228920077 TTTTGCAATGCTGGGGTTTGGGG + Intergenic
924443829 1:244109776-244109798 TTTGTCTATGCTAGGGTATTGGG - Intergenic
1064874767 10:19980806-19980828 TTTGGCTATATTTGGGGATGGGG - Intronic
1066002840 10:31120289-31120311 TTTTGCCATGGTGGGGGTTGGGG + Intergenic
1067757127 10:49013693-49013715 TTTGGCTCAGCTAAGGATTGGGG - Intergenic
1070375811 10:75830288-75830310 TTTGTGTATGCCAGGGGTTTGGG + Intronic
1073502521 10:103953648-103953670 TTTGGCCATTCTGGTGGTTGGGG + Intergenic
1074802637 10:117016950-117016972 TTTGGCTATGCTCATGCTTGTGG - Intronic
1074905998 10:117864443-117864465 TTTGGCCAGGATAGGGGTGGGGG - Intergenic
1075623740 10:123947012-123947034 TTTGCCTTTGTGAGGGGTTGAGG + Intergenic
1078404390 11:11057002-11057024 TTTGGCTCTGCTAGGAGGAGAGG + Intergenic
1081031225 11:38086173-38086195 TTTGGCTATGCTATTCCTTGGGG - Intergenic
1081805644 11:45888652-45888674 TTTGGGTATGGTATGGGGTGAGG + Intronic
1084496432 11:69506546-69506568 TTTAGCTATCCTAGTGGCTGTGG + Intergenic
1087153227 11:94877337-94877359 TTTTCCTATGCTAGGGCTGGGGG - Intergenic
1088272706 11:108051277-108051299 TTTGGCCATTCTATTGGTTGTGG + Intronic
1091646032 12:2273105-2273127 TTTTGGTATCCAAGGGGTTGGGG - Intronic
1092033681 12:5311601-5311623 TCTGCCAATGCAAGGGGTTGTGG + Intergenic
1092889690 12:12957473-12957495 TTGGGCTAGGCTAGGTGTGGTGG + Intergenic
1093274951 12:17114077-17114099 TTTGGATATGATAGAGGTTTTGG + Intergenic
1093615891 12:21224041-21224063 TTAGGCTAAGTTAGGGCTTGTGG - Intronic
1097407086 12:59202080-59202102 TTTGGATCTGTTAGGGGTGGAGG - Intergenic
1097459405 12:59842272-59842294 TTTCTCTATGGTGGGGGTTGGGG - Intergenic
1097904815 12:64908855-64908877 TTTGGCTATAGTAGGTGTTCTGG + Intergenic
1100929748 12:99593152-99593174 TCTGGCCATGATGGGGGTTGAGG - Intronic
1105640492 13:22258826-22258848 TTTGACTATGCTATGTCTTGGGG + Intergenic
1106736850 13:32596675-32596697 TTTAGCTATTCTAGTGGGTGTGG + Intronic
1111678783 13:91418643-91418665 TCTGGCTATGTTAAGGGTTTTGG + Intronic
1112414366 13:99192090-99192112 CTTGGCCATGCTAGGGGGAGGGG + Intergenic
1112630803 13:101159436-101159458 GTTGCCTATGCTGGGGATTGCGG + Intronic
1113901945 13:113802474-113802496 TTTGGATACTCTGGGGGTTGGGG - Intronic
1115494751 14:33992025-33992047 TTTGGCTATGCAGGGGACTGTGG + Intronic
1116107188 14:40525032-40525054 TTTATCTATGCTAGTGGTTGAGG - Intergenic
1117891827 14:60430412-60430434 TTTGGTTATGATAAGGGTTATGG + Intronic
1118285962 14:64472997-64473019 TTTTGCAAAGCTGGGGGTTGGGG + Exonic
1119274710 14:73343940-73343962 GGTGCCTATGTTAGGGGTTGGGG + Intronic
1120107251 14:80510093-80510115 TTTGGCTATTCTGGGTCTTGTGG + Intronic
1120266601 14:82258910-82258932 TATTACTATGCTAGGGCTTGTGG + Intergenic
1124465876 15:29939511-29939533 TGAGCCTGTGCTAGGGGTTGGGG - Intronic
1127462494 15:59212153-59212175 TCTGGCTACTCTAAGGGTTGGGG + Intronic
1127932050 15:63603471-63603493 TTTGGTTATGGTAAGGGATGGGG + Intergenic
1130409037 15:83629246-83629268 TTTGGCTATTCTAGGACTTTTGG - Intergenic
1131915431 15:97260201-97260223 TTTGGCATTGCTAGGTGGTGAGG + Intergenic
1132157876 15:99509181-99509203 TTTTCCTATGGTAGGGGTGGAGG + Intergenic
1132196056 15:99915597-99915619 TTTGGCTAGGCCAGGGGCGGTGG + Intergenic
1133804470 16:9114264-9114286 TGTGGGTAAGGTAGGGGTTGAGG + Intronic
1136625890 16:31462046-31462068 TTGGGGTCTGCTAGGGCTTGGGG + Intronic
1142747375 17:1966652-1966674 CTTGGCTATGTTAGTGGGTGGGG - Intronic
1143448707 17:7023196-7023218 TTGGGCTAAACTAGGGATTGGGG + Intronic
1144614120 17:16752591-16752613 TTTGGCTGTGCTGAGGGTGGGGG + Intronic
1144898590 17:18563076-18563098 TTTGGCTGTGCTGAGGGTGGGGG - Intergenic
1145133786 17:20382643-20382665 TTTGGCTGTGCTGAGGGTGGGGG + Intergenic
1145890635 17:28412869-28412891 TTTGGCAAGGCTGGGTGTTGTGG - Intergenic
1146924321 17:36733522-36733544 TCTGGCTGTGCTATGGGTCGGGG + Intergenic
1147885012 17:43678582-43678604 ATTGCCTATTCTGGGGGTTGAGG + Intergenic
1148648374 17:49232034-49232056 GCTGCCTATGCTAGGGGATGGGG - Intergenic
1148731793 17:49841382-49841404 TTTGGCCATGCTAGGCTTTCTGG - Intronic
1149667243 17:58373811-58373833 AGTGGCTATGATAGGGGTAGTGG - Intronic
1153345372 18:4020064-4020086 CTGGGTTATGGTAGGGGTTGTGG + Intronic
1153723528 18:7932198-7932220 TTTGATCAGGCTAGGGGTTGAGG + Intronic
1158073418 18:53500190-53500212 TTTGTTTTTGTTAGGGGTTGAGG + Intronic
1159680665 18:71347736-71347758 TTTTGCTATACTAGGTGTTCAGG + Intergenic
1160192853 18:76728828-76728850 TATGGATATGTTAGGGCTTGGGG + Intergenic
1160376782 18:78419888-78419910 TTTGGCTCTGCTAGGTTTTCTGG - Intergenic
1161299660 19:3536658-3536680 TCTGCCCATGCTAGGGGGTGGGG + Intronic
1163174097 19:15552178-15552200 TCTGGCTGAGCTAGGGGTGGAGG - Exonic
1166948115 19:46409450-46409472 TTTTTCACTGCTAGGGGTTGTGG + Intergenic
1167173676 19:47850596-47850618 TTTGTTTTTGCCAGGGGTTGGGG - Intergenic
1167270479 19:48503052-48503074 TTTGGTTCTGCTGGGGGTTGGGG - Intronic
925287162 2:2723372-2723394 GTTGGCTATGCTTGAGGGTGTGG - Intergenic
927153496 2:20208991-20209013 TTTGGCTCGCCTAGGGGCTGGGG + Intronic
929873806 2:45779434-45779456 TTGGGCTGTGCCAGGTGTTGTGG + Intronic
930903308 2:56534232-56534254 TATTTCTATGCTTGGGGTTGAGG - Intergenic
931416265 2:62084211-62084233 TTTGACTATGCTGGGCGTGGGGG - Intronic
932850696 2:75182062-75182084 TTAGCCTAAGCTAAGGGTTGTGG - Intronic
938801028 2:134763454-134763476 TTTCCCAATGCTAGGGGATGGGG - Intergenic
941840404 2:170076851-170076873 TTGGTCTATGGTAGGGGTGGTGG + Intronic
942889131 2:180965532-180965554 TTTGGCTGTGTCAGGGGGTGGGG + Intergenic
946043707 2:216803858-216803880 TTTGGCCAGGGTCGGGGTTGTGG + Intergenic
1169949798 20:11031281-11031303 TTTGGATATACTTTGGGTTGAGG + Intergenic
1170089200 20:12571573-12571595 TTTTGCTATACTAGTGGTTGAGG - Intergenic
1170844737 20:19952841-19952863 TTTTGTTTTGCTAGGGGCTGCGG - Intronic
1171273072 20:23831576-23831598 TTTGGCTCTGCTAGGACATGTGG + Intergenic
1171273080 20:23831634-23831656 TTTGGCTCTGCTAGGACATGTGG + Intergenic
1171273089 20:23831692-23831714 TTTGGCTCTGCTAGGACATGTGG + Intergenic
1175615522 20:60394791-60394813 TTGAACTATGGTAGGGGTTGTGG + Intergenic
1181088375 22:20455519-20455541 TCTGGCCATGCTAGGGGCTGAGG - Intronic
1181637627 22:24181704-24181726 TGTGGCTGTGCTAGGGGTGATGG + Intronic
1181803723 22:25362747-25362769 TGGGGCTGTGCTAGGGGCTGTGG - Intronic
1184010605 22:41745189-41745211 TTTGGCTGGGGTAGGGGTTGGGG + Intronic
1184098598 22:42329829-42329851 CTTGGCTTTGCTTGGGGATGGGG - Intronic
1184235323 22:43180137-43180159 TTTAGCTAAGCTAGGGGCTCCGG + Intronic
949288294 3:2432296-2432318 TTTGTATATGCTAGATGTTGGGG + Intronic
950950985 3:16998149-16998171 TCTGGCACTGCTTGGGGTTGAGG - Intronic
954667146 3:52261737-52261759 TATAGCTATGCTAGAGGGTGTGG - Intronic
956473821 3:69597665-69597687 TTTGGCCAGTCTAGTGGTTGTGG - Intergenic
962848448 3:139290229-139290251 CTGGGCTAGGCTAGGGGGTGGGG + Intronic
963732210 3:148985401-148985423 ATTGGTTGGGCTAGGGGTTGGGG + Intergenic
964458142 3:156891680-156891702 TTTGGCTAGGACAGGTGTTGAGG + Intronic
969458294 4:7313576-7313598 TTGGGCCATGCCAGGGATTGTGG + Intronic
970294824 4:14617983-14618005 TTTGGTTATTCTAGGGGATAGGG - Intergenic
971482289 4:27125496-27125518 GTTGGCTATGGTAAGGATTGAGG - Intergenic
972793553 4:42395344-42395366 TTTGCCTGGGCGAGGGGTTGGGG - Intergenic
972899813 4:43669283-43669305 TTTGGCTCTGCTAACTGTTGAGG - Intergenic
975357073 4:73419689-73419711 TTTGGTTAGGCTAGGGCTTAGGG + Intronic
978715682 4:111839972-111839994 TTTGGCTAGGTTTGGGATTGAGG + Intergenic
978934737 4:114360338-114360360 TGTGGCAATGCTAGGGAATGGGG + Intergenic
980254848 4:130365891-130365913 TTTTGTTGTTCTAGGGGTTGGGG - Intergenic
982254873 4:153441992-153442014 TTAGGATGTACTAGGGGTTGGGG + Intergenic
982684392 4:158470686-158470708 TTTGTTTATTCTGGGGGTTGGGG - Intronic
985705987 5:1401685-1401707 TTTGGCCATGCGAGGGGTAAGGG + Intronic
990284703 5:54289498-54289520 TTTGCCTATGCAAGGGGTTTGGG - Intronic
991338946 5:65583834-65583856 CCTGGCTATGCTAGAGGCTGAGG + Intronic
992666101 5:79011171-79011193 TTTGTCTATTATGGGGGTTGGGG - Intronic
992767729 5:80016772-80016794 TTTGTCTATGCTTGAGGTTTTGG - Intronic
995244719 5:109922606-109922628 TTTGGCTTTGTTTGGGGGTGGGG + Intergenic
995352080 5:111190164-111190186 TTTTTTTATGGTAGGGGTTGGGG - Intergenic
996838002 5:127815424-127815446 TTTGGGGATGATAGGGGGTGGGG + Intergenic
999190250 5:149741915-149741937 TGTGGCTATGCCAGGCGTGGTGG - Intronic
1000257911 5:159558449-159558471 TTTGGCTCTGCAGGGGTTTGGGG + Intergenic
1001348191 5:170928791-170928813 TTTGGCTATTCTAGGTCTTTTGG + Intronic
1001726738 5:173909132-173909154 CTTGGTTAAGCTAGGGGTTTAGG + Intronic
1002129864 5:177074058-177074080 ATTGGCTATGCTAGAGGGTCTGG - Intronic
1003570398 6:7252813-7252835 TGAGGCTCTGCTAGGAGTTGGGG - Intergenic
1006417642 6:33914075-33914097 TTTGGGGATGCTATGGGATGAGG - Intergenic
1009933770 6:70207898-70207920 GTTGGCTATGCTGGGTGTTTGGG - Exonic
1012441238 6:99264200-99264222 TTTAGGTATGCTACTGGTTGTGG + Intergenic
1017404351 6:154102196-154102218 TTTGGCTATCCTAGGATTTTGGG - Intronic
1019850607 7:3552720-3552742 TTAGGTCATTCTAGGGGTTGAGG + Intronic
1021256733 7:18401393-18401415 AGTGGCTATGCTGGTGGTTGGGG + Intronic
1021485298 7:21161211-21161233 TTTGTCTATGAAAGGGGCTGTGG + Intergenic
1022890700 7:34694993-34695015 TTTGGCTATGCTAGGCACGGTGG - Intronic
1023945888 7:44802892-44802914 TTTGCCTATCCTAGAGGTGGCGG + Exonic
1024855401 7:53772861-53772883 GCTGGCTATGCTAAGGGGTGTGG - Intergenic
1027509300 7:79059325-79059347 TTTTGATATGCCAGAGGTTGTGG - Intronic
1027521123 7:79209499-79209521 TTTGGCATTGCTAGAGGTAGAGG - Intronic
1031147138 7:118008923-118008945 TTTGGCTGGGCTGGGGGTGGCGG - Intergenic
1032796746 7:135283607-135283629 TTTGGCTGCCCTAGGGGATGGGG - Intergenic
1036449710 8:8855096-8855118 TTTTGGTATGCTGGGGGTGGGGG - Intronic
1038244601 8:25843543-25843565 TTTGGCTCTGCTAGAAGGTGAGG + Exonic
1040894869 8:52355378-52355400 TTTGGCTATGCTAGGGGTTGGGG - Intronic
1050127515 9:2374424-2374446 TTTGGCTATTCAAGGTGCTGTGG - Intergenic
1052822684 9:33151059-33151081 TTTGTCTGGACTAGGGGTTGGGG - Intronic
1056479712 9:86989084-86989106 TGTGGCTATGCTGAGAGTTGGGG - Intergenic
1060880116 9:127112197-127112219 TTGGGCTCTGCTAGGAGGTGGGG + Intronic
1061826996 9:133264602-133264624 TTTAGCCATGCTAGTGGATGAGG + Intronic
1062405284 9:136393276-136393298 TTTGGCCATGCCAGGGGTCCCGG - Intronic
1185563148 X:1076089-1076111 TTTGGGGTTGCTAGGGGCTGGGG + Intergenic
1187186337 X:16990259-16990281 TTAGTCCATGCCAGGGGTTGAGG + Intronic
1189188563 X:39075161-39075183 GTGGGCTATGCTAGGTGTAGTGG + Intergenic
1191888924 X:65920648-65920670 TTTTGCTATGGTGGGGGTTGGGG + Intergenic
1192142522 X:68657996-68658018 TATGGCTATGGTGGAGGTTGGGG + Intronic
1192557300 X:72100886-72100908 TGTGGCCATGCTACGGCTTGTGG - Intergenic
1192558253 X:72107514-72107536 TTTGGCTAAGCTGGGTGCTGAGG + Intergenic
1196233112 X:113248007-113248029 TTTGGCTATTCTGGGTCTTGTGG + Intergenic
1196634000 X:117978880-117978902 TTTGTGTATGCTTGGGGTTGTGG + Intronic
1197641053 X:128968430-128968452 TTTGGCCATCCTATGGGTTTAGG + Intergenic
1197758237 X:130010880-130010902 TCTGGCTATGCTGGAGGCTGAGG + Intronic
1198199335 X:134399637-134399659 TGTGTGTATGTTAGGGGTTGGGG - Intronic
1199194992 X:145017893-145017915 TTTGGCTAGGCTGGGCGTGGTGG - Intergenic
1200703404 Y:6421273-6421295 TGTGGCTCTGCTTGGGGTTTGGG - Intergenic
1200767639 Y:7093834-7093856 TCTGGCTTTTGTAGGGGTTGTGG - Intergenic
1200929771 Y:8686515-8686537 TTTAGCTATGCTACAGATTGTGG - Intergenic
1200930854 Y:8695820-8695842 TGTGGCTCTGCTAGGGTCTGTGG - Intergenic
1201030706 Y:9743434-9743456 TGTGGCTCTGCTTGGGGTTTGGG + Intergenic