ID: 1040894870

View in Genome Browser
Species Human (GRCh38)
Location 8:52355379-52355401
Sequence TTTTGGCTATGCTAGGGGTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 137}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040894870_1040894876 11 Left 1040894870 8:52355379-52355401 CCCAACCCCTAGCATAGCCAAAA 0: 1
1: 0
2: 0
3: 9
4: 137
Right 1040894876 8:52355413-52355435 GCAAGAATGTAGACAGAATGAGG No data
1040894870_1040894878 24 Left 1040894870 8:52355379-52355401 CCCAACCCCTAGCATAGCCAAAA 0: 1
1: 0
2: 0
3: 9
4: 137
Right 1040894878 8:52355426-52355448 CAGAATGAGGACAAACAGGCTGG No data
1040894870_1040894877 20 Left 1040894870 8:52355379-52355401 CCCAACCCCTAGCATAGCCAAAA 0: 1
1: 0
2: 0
3: 9
4: 137
Right 1040894877 8:52355422-52355444 TAGACAGAATGAGGACAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040894870 Original CRISPR TTTTGGCTATGCTAGGGGTT GGG (reversed) Intronic
900615162 1:3562444-3562466 TATTGACTATGCGAGGGTTTGGG - Intronic
901313733 1:8290865-8290887 TTTTGGTGATGCTGGGGGATGGG + Intergenic
903111014 1:21133546-21133568 TGTTGTCTATGCTATTGGTTTGG + Intronic
903860093 1:26359984-26360006 TTTTGGCTGGGTTAGGGGTCCGG - Intergenic
904959831 1:34323623-34323645 TTTTGGAAAAGCTAGGGGATGGG - Intergenic
908034083 1:60033103-60033125 ATTTGGTTTTGCTAAGGGTTGGG + Intronic
912673192 1:111650740-111650762 TTTTGTATATTCTATGGGTTTGG + Intronic
912729769 1:112091895-112091917 TTGTGGCTGTGTTAGGGGGTGGG - Intergenic
917350505 1:174072529-174072551 TGTGGGCTATGGTAGGAGTTTGG - Intergenic
918151043 1:181798532-181798554 TGTTGGCTCTGCTGGGGGTGCGG - Exonic
921590348 1:216995430-216995452 TATTGGCTAAGCTAAGGATTAGG - Intronic
922353031 1:224750398-224750420 TTTTGCTGTTGCTAGGGGTTGGG - Intergenic
924316215 1:242800275-242800297 TTTTGGCTTTGCTGTGGGATAGG + Intergenic
924413404 1:243831480-243831502 TTTTGGTTATGCTAGTTTTTCGG - Intronic
924443830 1:244109777-244109799 TTTTGTCTATGCTAGGGTATTGG - Intergenic
1062900655 10:1142883-1142905 TTTTGGACATTCTATGGGTTTGG + Intergenic
1063788811 10:9416035-9416057 TATTGGCAATGCTAGTGGTGTGG - Intergenic
1065916933 10:30360460-30360482 TTTTGTATATTCTAGGGGGTAGG - Intronic
1068456214 10:57257076-57257098 CTTTGGCTATGCTAAGGCATAGG - Intergenic
1069631051 10:69897264-69897286 TGTTGGCTTTCCAAGGGGTTGGG + Intronic
1070375810 10:75830287-75830309 CTTTGTGTATGCCAGGGGTTTGG + Intronic
1073502520 10:103953647-103953669 TTTTGGCCATTCTGGTGGTTGGG + Intergenic
1073959334 10:108908407-108908429 TTTTGTTTATCCTAGGGGTATGG + Intergenic
1074251533 10:111755582-111755604 TTTTGACTTTGCCAGTGGTTTGG - Intergenic
1074374067 10:112924660-112924682 TTTTAGCTATTCTGGGGGCTAGG + Intergenic
1074905999 10:117864444-117864466 TTTTGGCCAGGATAGGGGTGGGG - Intergenic
1074962628 10:118461872-118461894 TCTTGGCTGGGTTAGGGGTTGGG - Intergenic
1076181439 10:128411997-128412019 TTTTGGCAATGCTTTGTGTTGGG + Intergenic
1077080740 11:723696-723718 TTTTGGCTCTACCAGAGGTTGGG - Intronic
1081031226 11:38086174-38086196 TTTTGGCTATGCTATTCCTTGGG - Intergenic
1085360836 11:75884855-75884877 TTCTGGCTATTCTAGGTCTTTGG + Intronic
1090046273 11:123337087-123337109 TTTTGGCTATTCTAGGTCCTTGG - Intergenic
1091523395 12:1271230-1271252 TTTGGTCTATGCAAGAGGTTGGG + Intronic
1092461551 12:8691311-8691333 TTTTGGTTTTTGTAGGGGTTGGG + Intronic
1099114092 12:78602295-78602317 TTTTGTCTTTGCTAGGTTTTTGG - Intergenic
1099554470 12:84093485-84093507 TTTTGTCCATGGTTGGGGTTGGG - Intergenic
1105501774 13:20979269-20979291 TTTTGACTGTGCAGGGGGTTTGG + Intronic
1111404506 13:87785171-87785193 TTTTGGCTGTCCAAGGGGTGTGG - Intergenic
1111745811 13:92267856-92267878 TTTATTCTATTCTAGGGGTTGGG - Intronic
1111999882 13:95200243-95200265 TTTGGTCTATGCTAGGCTTTTGG - Intronic
1112684907 13:101813530-101813552 TTTTTGCCATTCTAGGGGCTGGG - Intronic
1116146809 14:41083690-41083712 TTCTGGCCATGCCAGGGGCTCGG + Intergenic
1116941641 14:50797156-50797178 TTTTGCCTATGGCAGGTGTTTGG - Intronic
1119274709 14:73343939-73343961 TGGTGCCTATGTTAGGGGTTGGG + Intronic
1120084520 14:80255012-80255034 TTATGGCTTTGCTCTGGGTTAGG - Intronic
1121774109 14:96578856-96578878 TCCTGGCTATGCTCTGGGTTAGG + Intergenic
1123764519 15:23463797-23463819 TTTATTCTATACTAGGGGTTGGG - Intergenic
1124398398 15:29326731-29326753 TGTTGGCTATTCTAGGTCTTTGG - Intronic
1128391582 15:67186224-67186246 TCTTGGCTCTGCTGGGGGTCAGG + Intronic
1129476735 15:75790902-75790924 TTTTGTATATGCTTGGGGGTAGG + Intergenic
1133663928 16:7946621-7946643 TTTTTTCTTTGTTAGGGGTTAGG + Intergenic
1134206692 16:12243928-12243950 TTGTGGCTCTGGTAGAGGTTAGG + Intronic
1146924320 17:36733521-36733543 TTCTGGCTGTGCTATGGGTCGGG + Intergenic
1147370665 17:39990399-39990421 TCTTCTCTATGCTAGGGGCTAGG + Intronic
1153254111 18:3152998-3153020 TTCTGGAGCTGCTAGGGGTTTGG + Intronic
1155285559 18:24285219-24285241 TTTTGGCAAAGCTTGGTGTTTGG - Intronic
1156630745 18:38965319-38965341 TTTTGATTATGCCAGTGGTTTGG + Intergenic
1160192852 18:76728827-76728849 TTATGGATATGTTAGGGCTTGGG + Intergenic
1161299659 19:3536657-3536679 TTCTGCCCATGCTAGGGGGTGGG + Intronic
1161953389 19:7479764-7479786 TTTTGGGCATCCTATGGGTTTGG - Intronic
1163109127 19:15147797-15147819 TTTTGGCCCTGCTAGTGGCTTGG + Intergenic
1167270480 19:48503053-48503075 GTTTGGTTCTGCTGGGGGTTGGG - Intronic
1167873622 19:52393569-52393591 TTTTAGCTATTTTAGGTGTTTGG + Intergenic
927820897 2:26263909-26263931 GTTGTGCTATGCTGGGGGTTTGG - Intronic
927836811 2:26405599-26405621 TTTTGGCTATGATAATGGTATGG + Intronic
930215571 2:48692892-48692914 TTTTGGAGATGCTAGAGATTAGG + Intronic
931416266 2:62084212-62084234 TTTTGACTATGCTGGGCGTGGGG - Intronic
933099442 2:78233671-78233693 TTTTGGACAATCTAGGGGTTGGG - Intergenic
935656989 2:105431643-105431665 TGTTGGCTATGGTTGGAGTTAGG + Intronic
937140105 2:119592818-119592840 CTTTGGCTTTGCTAGGAATTTGG + Intronic
938823432 2:134981107-134981129 CTTTGGCTGTGCCAGGCGTTTGG - Exonic
942662938 2:178285427-178285449 TTTTGGCTATTTTAAGGTTTAGG - Intronic
946746268 2:222848814-222848836 TTTTGTTTATGCTATTGGTTAGG - Intergenic
948157645 2:235797146-235797168 TTTTGTCTTTCCAAGGGGTTTGG + Intronic
948966768 2:241388103-241388125 TTTTGGCTATTTTAGGTTTTTGG - Intronic
1170975222 20:21157656-21157678 TTTTGCCTATCTTAGGGGGTTGG + Intronic
1171027042 20:21640340-21640362 TTTTTGCTTTGCTAAGGGGTGGG + Intergenic
1172218796 20:33257558-33257580 TTTTTGCTATGCTATGGCTGTGG - Intergenic
1172880009 20:38193785-38193807 GTTTGGCTCTGCCAGGGGCTGGG + Intergenic
1173919322 20:46731941-46731963 TCCTGGCTAAGTTAGGGGTTAGG - Intronic
1174506501 20:51021038-51021060 GTTTGGCAAAACTAGGGGTTTGG + Intronic
1177410397 21:20722195-20722217 TTTTGTCTATGGTATGGGGTTGG + Intergenic
1177706732 21:24715475-24715497 TTTTTGCGATCCTAGGGATTAGG - Intergenic
1179730801 21:43366272-43366294 TGTTGGGCATTCTAGGGGTTTGG - Intergenic
1180912480 22:19461268-19461290 TTTTGACTATGGTATGAGTTAGG + Intronic
1181060915 22:20281648-20281670 TTTTGGGGATCCTGGGGGTTGGG + Intronic
1183133282 22:35860654-35860676 TTTTGGCTATTCTAGGTCTTTGG + Intronic
1183141029 22:35939270-35939292 TTTTGGTTATCCTAGTGTTTAGG - Intronic
1184010604 22:41745188-41745210 CTTTGGCTGGGGTAGGGGTTGGG + Intronic
949288293 3:2432295-2432317 TTTTGTATATGCTAGATGTTGGG + Intronic
954672195 3:52297152-52297174 TTTGGGATATGCTAGGGGAAGGG + Intergenic
956398871 3:68854988-68855010 TTTTTACTCTGCTATGGGTTTGG - Intronic
957465033 3:80578186-80578208 TTTAGGCTATGCTAGGCTTTGGG + Intergenic
970294825 4:14617984-14618006 TTTTGGTTATTCTAGGGGATAGG - Intergenic
972422544 4:38902706-38902728 TTTTGGGGATACTTGGGGTTTGG + Intronic
974495722 4:62624155-62624177 TTTTGACTGTGTTGGGGGTTTGG - Intergenic
975357072 4:73419688-73419710 GTTTGGTTAGGCTAGGGCTTAGG + Intronic
979680240 4:123451493-123451515 TTTTGGTGATGCTAGGCATTTGG + Intergenic
981764604 4:148234219-148234241 GTTTCTCTATGCTAGGTGTTAGG + Intronic
982684393 4:158470687-158470709 TTTTGTTTATTCTGGGGGTTGGG - Intronic
983191373 4:164757097-164757119 TTTTAGCTATGTTAGTGGTTAGG + Intergenic
983872296 4:172836092-172836114 TTCTGGCTCTGCTGGGGGCTTGG - Intronic
985705986 5:1401684-1401706 GTTTGGCCATGCGAGGGGTAAGG + Intronic
989719937 5:44513878-44513900 TTTTAGCAATTCTAGGTGTTTGG - Intergenic
990284704 5:54289499-54289521 GTTTGCCTATGCAAGGGGTTTGG - Intronic
993970342 5:94412267-94412289 TTTTGGTTATTCTAAGGGGTAGG - Intronic
994078387 5:95679344-95679366 TTTTGGCTATGCTCTGGAGTAGG - Intronic
995005521 5:107189770-107189792 TTTTGGCTCTGGCAGGGGGTAGG + Intergenic
1003570399 6:7252814-7252836 TTGAGGCTCTGCTAGGAGTTGGG - Intergenic
1004675392 6:17837048-17837070 TTGTGGCTATCATAGAGGTTTGG + Exonic
1009933771 6:70207899-70207921 AGTTGGCTATGCTGGGTGTTTGG - Exonic
1013340795 6:109213755-109213777 TTGTGGCTTTGCTTGGGGTAAGG + Intergenic
1014669665 6:124285708-124285730 TTTTGGCTGTGTGGGGGGTTTGG - Intronic
1016874784 6:148853891-148853913 TTTTGGGTATGCAGGGGGTAGGG - Intronic
1017404352 6:154102197-154102219 TTTTGGCTATCCTAGGATTTTGG - Intronic
1022327788 7:29347694-29347716 TTTGGGCTATGATATGGCTTCGG - Intronic
1023755037 7:43408342-43408364 TGTTGCCTTTGCCAGGGGTTAGG + Intronic
1025935160 7:66029963-66029985 TTTGGACTTTGCTAGGCGTTTGG - Intergenic
1025949152 7:66129726-66129748 TTTGGACTTTGCTAGGTGTTTGG + Intronic
1027248466 7:76383399-76383421 TTTTGGCTATGAAACGGTTTGGG - Intergenic
1027434352 7:78148845-78148867 TAATGTCTATGCTAGGGGTTTGG + Intronic
1027963604 7:84978222-84978244 TGTTGTCTATTCTATGGGTTGGG + Intergenic
1031566965 7:123311461-123311483 TGTTGGATATTCTATGGGTTTGG - Intergenic
1032698410 7:134357772-134357794 TTTGGACTATGCTCGGTGTTAGG + Intergenic
1038285415 8:26202218-26202240 TTTTGGCTAAGCAATGGGGTTGG - Intergenic
1039033630 8:33335566-33335588 TTTTGACTAATGTAGGGGTTAGG + Intergenic
1040894870 8:52355379-52355401 TTTTGGCTATGCTAGGGGTTGGG - Intronic
1046064027 8:109175494-109175516 TTTTGGTTATAGTGGGGGTTAGG + Intergenic
1046373362 8:113342030-113342052 TTTTGGCTATTCTACGAGTTTGG - Intronic
1046757736 8:117989169-117989191 TTTTGCCTCTGCTATGGCTTAGG - Intronic
1049166730 8:141130482-141130504 TTTTGATTCTGTTAGGGGTTTGG + Intronic
1056846975 9:90046764-90046786 TTTTAGCTATACTAGCTGTTTGG + Intergenic
1059916155 9:119103868-119103890 TTTTAGCTATTCTAGGTTTTTGG + Intergenic
1060880115 9:127112196-127112218 TTTGGGCTCTGCTAGGAGGTGGG + Intronic
1061645410 9:131997011-131997033 TTTTGACTATGGTGGGGGATGGG + Intronic
1186258784 X:7752797-7752819 CTTTGTCTGTGCTTGGGGTTGGG + Intergenic
1189312931 X:40032766-40032788 TTTTGGCTCTTCTGGGGGCTTGG + Intergenic
1191888923 X:65920647-65920669 CTTTTGCTATGGTGGGGGTTGGG + Intergenic
1195777399 X:108422717-108422739 CTTTGGCTATCCTAGCCGTTAGG + Intronic
1195810786 X:108826428-108826450 TTTTAGCTATTCTAGGGCTAGGG - Intergenic
1198702192 X:139408997-139409019 TTTTGGCTATTCTGGGTCTTTGG + Intergenic
1199048714 X:143209506-143209528 CTTTGGCTATTCTGGGTGTTTGG - Intergenic
1200660817 Y:5955240-5955262 TTTTGGCTATTCTGGGTCTTTGG - Intergenic
1200703405 Y:6421274-6421296 ATGTGGCTCTGCTTGGGGTTTGG - Intergenic
1200977611 Y:9229314-9229336 TTTTGTTTATGCTTAGGGTTAGG - Intergenic
1201030705 Y:9743433-9743455 ATGTGGCTCTGCTTGGGGTTTGG + Intergenic
1202076659 Y:21043566-21043588 ACTTGGTGATGCTAGGGGTTTGG + Intergenic