ID: 1040894871

View in Genome Browser
Species Human (GRCh38)
Location 8:52355380-52355402
Sequence ATTTTGGCTATGCTAGGGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 99}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040894871_1040894878 23 Left 1040894871 8:52355380-52355402 CCAACCCCTAGCATAGCCAAAAT 0: 1
1: 0
2: 0
3: 10
4: 99
Right 1040894878 8:52355426-52355448 CAGAATGAGGACAAACAGGCTGG No data
1040894871_1040894877 19 Left 1040894871 8:52355380-52355402 CCAACCCCTAGCATAGCCAAAAT 0: 1
1: 0
2: 0
3: 10
4: 99
Right 1040894877 8:52355422-52355444 TAGACAGAATGAGGACAAACAGG No data
1040894871_1040894876 10 Left 1040894871 8:52355380-52355402 CCAACCCCTAGCATAGCCAAAAT 0: 1
1: 0
2: 0
3: 10
4: 99
Right 1040894876 8:52355413-52355435 GCAAGAATGTAGACAGAATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040894871 Original CRISPR ATTTTGGCTATGCTAGGGGT TGG (reversed) Intronic
900191285 1:1353359-1353381 ATTTTGGTTGTGCCAGGGGTGGG + Intronic
901233086 1:7652047-7652069 ATTTGGGGTATGGTGGGGGTGGG - Intronic
902067984 1:13705151-13705173 TTTTCGGCTATGGTGGGGGTAGG + Exonic
902664807 1:17930085-17930107 ATTTTGGATTTGCTAGAGATGGG + Intergenic
904120526 1:28194778-28194800 ATTTTGGTTGTGGTAGGGGGCGG - Intergenic
904959832 1:34323624-34323646 ATTTTGGAAAAGCTAGGGGATGG - Intergenic
906124075 1:43415889-43415911 ATTCTGGCTTTGCTATGGATGGG + Intronic
908034082 1:60033102-60033124 AATTTGGTTTTGCTAAGGGTTGG + Intronic
916656513 1:166881106-166881128 ATTTTTGCTATGCTAGGCCCTGG - Intergenic
917994335 1:180419560-180419582 TTTTTGACTATGCAGGGGGTCGG - Intronic
921259316 1:213371634-213371656 ATAGTGGCTATCCTAGTGGTTGG + Intergenic
924256930 1:242192014-242192036 AGTATGGCTGTGCTAGGGTTAGG + Intronic
1069083056 10:64108504-64108526 ATATGTGCTATGCTAGGGGAAGG - Intergenic
1070508834 10:77141088-77141110 ATTTGGGTTATGTTAGTGGTGGG - Intronic
1072588628 10:96806022-96806044 ATTTTGAAGATGCTTGGGGTAGG + Intergenic
1073502519 10:103953646-103953668 ATTTTGGCCATTCTGGTGGTTGG + Intergenic
1074906000 10:117864445-117864467 ATTTTGGCCAGGATAGGGGTGGG - Intergenic
1080193101 11:29574492-29574514 ATTTGGGCTTTCCTTGGGGTTGG - Intergenic
1080955995 11:37096470-37096492 CTTTTGACTATGCAAGGGGTTGG + Intergenic
1081197894 11:40183827-40183849 CTTGTGGTTATGCTAGAGGTTGG + Intronic
1081491100 11:43569632-43569654 ATTTTGGCTTTACTGGGGATGGG - Intronic
1081612781 11:44573010-44573032 AATTTGGCTCTGCGAGGGGCGGG + Intronic
1085120241 11:73962957-73962979 ATTTTGGCTATGTAATGGTTAGG - Intronic
1090658936 11:128867279-128867301 AGTTTGGATATGCTAGGTGAGGG + Intronic
1095566639 12:43631981-43632003 ATTTTGGCTATCTTAGGCCTGGG - Intergenic
1103421498 12:120788195-120788217 ATTTTAGCTATTCTGGTGGTGGG + Intronic
1107657579 13:42607202-42607224 ATGTGGGCTATGGGAGGGGTTGG + Exonic
1110039842 13:70739948-70739970 ATTTTGGCATTGCTAGAAGTTGG + Intergenic
1112702305 13:102024305-102024327 ATTTTGGTTATCCTAGGAGTGGG + Intronic
1115917891 14:38337402-38337424 ATATTGCACATGCTAGGGGTTGG + Intergenic
1122566315 14:102659360-102659382 ATTTTGGCTATTCTGGTGGTGGG + Intronic
1125307827 15:38341587-38341609 ATTTTGCCAATGATAGGTGTTGG - Intronic
1127772313 15:62241923-62241945 ATTTTGTATATTCTGGGGGTAGG - Intergenic
1130897126 15:88180160-88180182 ATAGTGGCTATTCTAGGGATGGG - Intronic
1135203487 16:20461116-20461138 ATTCTGGCTAGGGTAGGGGAAGG + Intronic
1136491145 16:30609431-30609453 GTTTTGGTTGGGCTAGGGGTGGG - Intronic
1138452136 16:57099569-57099591 ATTTTGGCCGTCCTGGGGGTGGG + Intronic
1146924319 17:36733520-36733542 ATTCTGGCTGTGCTATGGGTCGG + Intergenic
1148565620 17:48631381-48631403 ATTTCCCCTAGGCTAGGGGTGGG + Intronic
1149853269 17:60054472-60054494 CTTCTGGCTTTGCTAGGTGTAGG - Intronic
1150830567 17:68514845-68514867 ATTTTGATTATGCTAGTAGTTGG + Intronic
1154313863 18:13288289-13288311 ATTTTGGCTAAGCTAATGGAAGG - Intronic
1155336401 18:24769691-24769713 ATTGAGGCAATGCTTGGGGTTGG - Intergenic
1157548120 18:48561851-48561873 ATTTGGTCTAGGCTGGGGGTTGG + Intronic
1160009594 18:75095903-75095925 ATTTTGGCTATGCTGTGTCTGGG + Intergenic
1160091090 18:75827207-75827229 ATATTGTCTATGTTATGGGTTGG - Intergenic
1160192851 18:76728826-76728848 ATTATGGATATGTTAGGGCTTGG + Intergenic
1167270481 19:48503054-48503076 AGTTTGGTTCTGCTGGGGGTTGG - Intronic
931416267 2:62084213-62084235 TTTTTGACTATGCTGGGCGTGGG - Intronic
937564124 2:123262858-123262880 ATTTTGGCTTTCCAAGGGTTAGG + Intergenic
939042292 2:137205089-137205111 ATTTTGGCTATGGTAGGATCTGG - Intronic
941268388 2:163393205-163393227 ATTTTGCTTCTGCTGGGGGTGGG - Intergenic
943759970 2:191597237-191597259 ATTTTGGATGATCTAGGGGTGGG + Intergenic
1172006436 20:31821731-31821753 ATTTTGGGTAGGCCAGGGGCAGG + Exonic
1172880008 20:38193784-38193806 AGTTTGGCTCTGCCAGGGGCTGG + Intergenic
1177378650 21:20308290-20308312 ATTCTGGGTATGCTGGGGCTGGG - Intergenic
1181907087 22:26207055-26207077 ATATTAGCTTTACTAGGGGTTGG + Intronic
1184010603 22:41745187-41745209 ACTTTGGCTGGGGTAGGGGTTGG + Intronic
950156995 3:10729036-10729058 TTTTTGACTGTGCAAGGGGTTGG + Intergenic
950242690 3:11385909-11385931 ATTTTGGCCATCCTTGGAGTTGG + Intronic
954672194 3:52297151-52297173 ATTTGGGATATGCTAGGGGAAGG + Intergenic
957002920 3:74907787-74907809 TTTTTGACTATGCAGGGGGTTGG + Intergenic
957465032 3:80578185-80578207 GTTTAGGCTATGCTAGGCTTTGG + Intergenic
959468741 3:106722074-106722096 ATTTTGACTTTGCTATGTGTGGG + Intergenic
960187915 3:114666629-114666651 ATTTTGCACATGCTAGGGATTGG + Intronic
960631365 3:119734743-119734765 ATTTTGACTATGTATGGGGTTGG + Intronic
962432792 3:135335616-135335638 ATTATGGCTGTGGTAGGAGTGGG + Intergenic
963347898 3:144117910-144117932 ATTGTGGGTCTACTAGGGGTGGG + Intergenic
973046806 4:45543883-45543905 ATTGTGTCTCTGCTAGGGGTTGG - Intergenic
976942130 4:90715401-90715423 ATTTGGGTTATTCTAGGGTTTGG + Intronic
977317413 4:95467705-95467727 TTTTTGGCTATGTGAAGGGTTGG - Intronic
977686715 4:99855030-99855052 ATTTTGGCTTTGTTAGAAGTGGG + Intronic
978001560 4:103560165-103560187 TTTTTAGCTGTGCAAGGGGTTGG - Intergenic
979438198 4:120720087-120720109 AGCTTGGCTATGCTGGGGTTGGG - Intronic
983860633 4:172701589-172701611 ACTTTAGCTATGCTAGGGGCTGG + Intronic
984184342 4:176524576-176524598 ATTTTGGCTATCTTATGTGTTGG + Intergenic
984634016 4:182091820-182091842 TGTTTGGTGATGCTAGGGGTAGG - Intergenic
987601392 5:20076285-20076307 ATTTTGGGTGTGTTTGGGGTGGG + Intronic
988030052 5:25752435-25752457 ATATTGGCTAGGGTTGGGGTTGG - Intergenic
990694665 5:58402233-58402255 ATTTTTGCTAAGGCAGGGGTTGG - Intergenic
994309259 5:98248342-98248364 AATATGGCTTTGCTAGGGTTTGG - Intergenic
996079309 5:119238589-119238611 ATTTTCACTATGCTAGGAGAAGG + Intronic
999309048 5:150539809-150539831 ATTTTGTAAATGTTAGGGGTGGG - Intronic
1002829824 6:809610-809632 ATATTGCCAATTCTAGGGGTAGG + Intergenic
1002962368 6:1927530-1927552 ATTTTGGCTCCAGTAGGGGTTGG - Intronic
1005673643 6:28132391-28132413 ATTTTGGCTATCCTAAGATTAGG + Intergenic
1007625283 6:43243197-43243219 ATTTTAGACATGCTAGGAGTGGG + Intergenic
1007947306 6:45838102-45838124 ATTTTGTATGTGTTAGGGGTGGG - Intergenic
1009542060 6:64972769-64972791 ATTTTGACTATTTCAGGGGTTGG + Intronic
1012395092 6:98787395-98787417 ATTTTAGCCATGCTAGTGGGCGG - Intergenic
1016874785 6:148853892-148853914 ATTTTGGGTATGCAGGGGGTAGG - Intronic
1028441671 7:90870053-90870075 ATTTTGGCTATTCTAATGGCAGG + Intronic
1031468562 7:122143651-122143673 AGTTTGGCTAAGCTGGGCGTGGG + Intronic
1032613873 7:133444742-133444764 ATTTTGGCTATGTTAAATGTGGG + Intronic
1036449712 8:8855098-8855120 AATTTTGGTATGCTGGGGGTGGG - Intronic
1038631621 8:29250458-29250480 ATTTTGGATTTTCTAGGGATTGG - Intronic
1040894871 8:52355380-52355402 ATTTTGGCTATGCTAGGGGTTGG - Intronic
1041668722 8:60471183-60471205 GTTTTGGCTATTCTAGGTTTTGG - Intergenic
1048467393 8:134677615-134677637 ATTTTGTCTCTGCTAGGTTTTGG - Intronic
1050836302 9:10083707-10083729 ATTTTTTCTATGGTAGGAGTCGG + Intronic
1052548476 9:29912858-29912880 CTTTTGGCTATCTTTGGGGTGGG - Intergenic
1054709377 9:68496100-68496122 TTTTAGGTTATACTAGGGGTTGG - Intronic
1055084063 9:72296137-72296159 ATCTTGGTTATGCTATGGCTAGG + Intergenic
1055986094 9:82057455-82057477 ATTTTTGCCATGCTTGGTGTGGG - Intergenic
1060929102 9:127477351-127477373 ATTTTGCCTATACTAATGGTAGG - Intronic
1061062187 9:128256026-128256048 ATTTTGTATATTCCAGGGGTAGG - Exonic
1195810787 X:108826429-108826451 GTTTTAGCTATTCTAGGGCTAGG - Intergenic
1198190357 X:134298802-134298824 ATGTTGGCACTGCCAGGGGTGGG - Intergenic
1200849146 Y:7864771-7864793 ATTTTAGCTATGCTATGTTTAGG + Intergenic
1200964120 Y:9020876-9020898 GTTTTGGCTATCCTAGGAGAGGG - Intergenic