ID: 1040894872

View in Genome Browser
Species Human (GRCh38)
Location 8:52355384-52355406
Sequence CTACATTTTGGCTATGCTAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 116}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040894872_1040894876 6 Left 1040894872 8:52355384-52355406 CCCCTAGCATAGCCAAAATGTAG 0: 1
1: 0
2: 0
3: 15
4: 116
Right 1040894876 8:52355413-52355435 GCAAGAATGTAGACAGAATGAGG No data
1040894872_1040894877 15 Left 1040894872 8:52355384-52355406 CCCCTAGCATAGCCAAAATGTAG 0: 1
1: 0
2: 0
3: 15
4: 116
Right 1040894877 8:52355422-52355444 TAGACAGAATGAGGACAAACAGG No data
1040894872_1040894878 19 Left 1040894872 8:52355384-52355406 CCCCTAGCATAGCCAAAATGTAG 0: 1
1: 0
2: 0
3: 15
4: 116
Right 1040894878 8:52355426-52355448 CAGAATGAGGACAAACAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040894872 Original CRISPR CTACATTTTGGCTATGCTAG GGG (reversed) Intronic
900503720 1:3018878-3018900 CTAGATTTTGGCTCTGCCGGTGG - Intergenic
907384248 1:54115751-54115773 CTACCTTGTGGCTATTCTTGGGG - Intergenic
913383697 1:118236908-118236930 CTACCTTTTTGATATGCTATTGG - Intergenic
913523330 1:119667115-119667137 TTTCATTTTGGCTATTCTAGTGG + Intronic
917844861 1:179012071-179012093 TTTCATTTTGGCTATTCTGGGGG - Intergenic
922501241 1:226098536-226098558 CTATATTTTGGGTAAGCTGGGGG - Intergenic
924466355 1:244302217-244302239 CTCAATTGTGGCTATTCTAGTGG + Intergenic
1073955509 10:108866742-108866764 CTATATTTTATATATGCTAGAGG + Intergenic
1074761866 10:116673009-116673031 CTGCATATTGGCTATGATAATGG + Exonic
1075273829 10:121076136-121076158 CAACATTTGGGCTAGGCTGGAGG + Intergenic
1075864420 10:125705453-125705475 CTATATATTTGCTTTGCTAGAGG + Intergenic
1078499663 11:11858468-11858490 CTATATTTTGACTATGGTAGTGG - Intronic
1082222198 11:49652569-49652591 CTGCATTTTGGGTATGTTATAGG - Intergenic
1085672297 11:78479218-78479240 ATACATTTTTGCTTTGCTAATGG + Intronic
1088556009 11:111061704-111061726 CTGGATTTTGGCTATTCTAGTGG - Intergenic
1089688936 11:120174132-120174154 CTTCATTTTGGCTCTGCTCAGGG + Intronic
1091506182 12:1071339-1071361 CTAAATTTTAGCCATTCTAGTGG + Intronic
1097944388 12:65350348-65350370 TTACATTTTGGCAAAGCTGGAGG - Intronic
1099001968 12:77188832-77188854 TTACATTTTGGCAATACTAAGGG + Intergenic
1100502357 12:95186054-95186076 CTACATTTTGGGATTTCTAGGGG - Intronic
1101479324 12:105082288-105082310 CTACATCTTGATTATGGTAGTGG - Intronic
1105804287 13:23941711-23941733 CTACATTTGGCCTGTGCCAGCGG - Intergenic
1105842641 13:24268201-24268223 CTACCTTTTGGATATCCTACAGG - Intronic
1107391519 13:39969631-39969653 CTTCATTTTGGCTGGGCTTGAGG - Intergenic
1107617357 13:42183648-42183670 CTACATGTTAGCTATGTTAGTGG - Intronic
1108231070 13:48341589-48341611 TTACATTTTAGCTATTCTAGTGG + Intronic
1111242290 13:85490778-85490800 CTACATTTTTCCTTTGCTAGTGG - Intergenic
1115341060 14:32293308-32293330 TTACACTTTGCCTATGTTAGTGG - Intergenic
1115765695 14:36621069-36621091 TTACATTTTAGCCATTCTAGTGG + Intergenic
1118660604 14:68005605-68005627 CTATATTTTAGCTACTCTAGTGG + Intronic
1123975228 15:25547241-25547263 CTTCATTTTTGCCATTCTAGGGG + Intergenic
1128418701 15:67470905-67470927 CTACATTTTGGGTATAAAAGGGG - Intronic
1137816105 16:51398994-51399016 CAACATCTTGGCTGTGCTAATGG - Intergenic
1139837619 16:69852199-69852221 CTGGATTTTGGCTATTCTAATGG + Intronic
1141295719 16:82767233-82767255 CTGCATTTTGGCAATGCTTTGGG - Intronic
1142751471 17:1990945-1990967 CTCCATTGTGGCTATGCAGGGGG - Intronic
1143235553 17:5396806-5396828 TTTCATTTTAGCTATACTAGTGG + Intronic
1147695505 17:42349431-42349453 CTACATTTTGGCTACAGTACAGG - Intronic
1151371620 17:73650192-73650214 CTAAATGTAGGCTAGGCTAGAGG + Intergenic
1154417081 18:14183659-14183681 CTACATTTGGCCTGTGCCAGTGG + Intergenic
1156474454 18:37396986-37397008 CTTCATTTTGGCCAAGCTATTGG + Intronic
1156694301 18:39748523-39748545 CTGCATTTTGTCTATGCTCTAGG + Intergenic
1161391139 19:4021101-4021123 TTTCATTTTAGCCATGCTAGTGG + Intronic
1167350002 19:48968639-48968661 CTACACTTTGGCCAAGCAAGAGG - Exonic
932171562 2:69562252-69562274 TTTCATTTTAGCTATTCTAGTGG + Intronic
932557466 2:72837448-72837470 TTTCATTTTAGCTATTCTAGTGG + Intergenic
932980594 2:76661361-76661383 CTCAATTTTGGCAATGGTAGTGG - Intergenic
933109152 2:78375031-78375053 CTACAGTTTGGATGTGCTAAAGG + Intergenic
933864450 2:86503301-86503323 CTGGGTTTTGGCTATGCTAATGG - Intergenic
936101177 2:109581072-109581094 CTATATTAGAGCTATGCTAGTGG + Intronic
939459644 2:142483237-142483259 CTACATCTTGGCCAGGGTAGTGG - Intergenic
939968896 2:148638527-148638549 CTACCTCTTGGCTTTGCCAGTGG + Intergenic
940956744 2:159737469-159737491 TTTTATTTTGGCTATGCTAGTGG - Intronic
944385759 2:199162716-199162738 CTACATGTTGCCTATTCTACAGG + Intergenic
944946387 2:204691375-204691397 CTAAATTTTGCCTATCCTAGGGG + Intronic
945112904 2:206380223-206380245 CTACATTTTGGCGGTGGTGGTGG + Intergenic
945530096 2:210942500-210942522 TTACATTTTAGCCATTCTAGTGG - Intergenic
947433626 2:230053272-230053294 TTTGATTTTGGCAATGCTAGTGG - Intronic
1171891382 20:30720301-30720323 CTACATTTGGCCTGTGCCAGTGG - Intronic
1176856254 21:13975605-13975627 CTACATTTGGCCTGTGCCAGTGG - Intergenic
1176868337 21:14068644-14068666 CTACATTTGGCCTGTGCCAGTGG + Intergenic
1177658595 21:24052413-24052435 CTACAGTTTGCCTATGAAAGTGG - Intergenic
1178099752 21:29254494-29254516 CTATATTTTGACTGTGGTAGTGG - Intronic
1179155206 21:38844262-38844284 TTTCATTTTAGCCATGCTAGAGG + Intergenic
949913334 3:8934548-8934570 CTCCATTTTAGCCATTCTAGTGG - Intronic
951059224 3:18185248-18185270 CTACATCTTGGCCATACCAGTGG - Intronic
951737471 3:25883880-25883902 CTACATTTTGTCTCTTCTATTGG + Intergenic
952275581 3:31872549-31872571 TTACATTTTAGCTATTTTAGTGG - Intronic
957392377 3:79593435-79593457 CTAGGTTTTGGCCATTCTAGTGG + Intronic
958764148 3:98344436-98344458 CTAAAGTTTGGCTATGGTAGTGG + Intergenic
959780167 3:110222145-110222167 CTACATATTTGCTATGGCAGAGG - Intergenic
959839900 3:110963241-110963263 CCACATATTTTCTATGCTAGTGG + Intergenic
960826884 3:121796481-121796503 CATCATTTTGAGTATGCTAGAGG + Intronic
962589390 3:136873314-136873336 CTGTATTTTGGATTTGCTAGAGG + Intronic
963702072 3:148638920-148638942 CTACATCTTGCCTATGGTAGTGG + Intergenic
970100180 4:12512897-12512919 TTGCATTTTGGCTAAGCAAGGGG + Intergenic
971447456 4:26766111-26766133 CTACTTTTCTCCTATGCTAGGGG - Intergenic
972852206 4:43064181-43064203 CTAAATTATGGCTATGGTATGGG + Intergenic
972954960 4:44377492-44377514 CTTCTTTTAGGCTATGCTTGAGG - Intronic
977472709 4:97461273-97461295 CTGCATTTTAGCCATGCTAATGG + Intronic
982532717 4:156566786-156566808 CTAGATGTTGGCTCTGGTAGTGG - Intergenic
982658660 4:158179480-158179502 ATAATTTTTGGCTATGCTACAGG - Intergenic
983860632 4:172701585-172701607 TTACACTTTAGCTATGCTAGGGG + Intronic
987451506 5:18089524-18089546 CAACATCTTGGCTAGGTTAGGGG - Intergenic
987629801 5:20454872-20454894 CTACATTTTGTCTAGGAAAGGGG + Intronic
989491740 5:42063460-42063482 TTACATTTTGGCTATTGTAAAGG - Intergenic
991090512 5:62689800-62689822 CTGCATTTTAGCAATGGTAGCGG + Intergenic
993003759 5:82409082-82409104 TTAAATTTTAGCTATTCTAGTGG + Intergenic
994109308 5:95982374-95982396 CTATATTTTGATTGTGCTAGTGG - Intergenic
994542734 5:101121116-101121138 CTAGATTTTGGCTTTGCATGGGG - Intergenic
996448361 5:123585766-123585788 TTAAATTTTAGCCATGCTAGTGG - Intronic
998827255 5:146115073-146115095 CTACATTTTAGCTTTGCTCCTGG - Intronic
999012840 5:148061330-148061352 CTCCATTTGGGCTAGGCTAGGGG + Intronic
1000262091 5:159597811-159597833 CTACAACTTGGATATGCTAAAGG + Intergenic
1001708437 5:173759072-173759094 CTGCATGTTGGCTATGGCAGAGG - Intergenic
1002723320 5:181279333-181279355 CTACATTTTTGATATGCTGATGG - Intergenic
1005646859 6:27847468-27847490 CCACATTTTTGTTATGATAGAGG + Intronic
1010358291 6:74962162-74962184 TTACCTTTTTGCTATGCTATTGG + Intergenic
1012265119 6:97132188-97132210 CTTCATTTGGGGCATGCTAGGGG + Intronic
1024255750 7:47538869-47538891 CTAAAGTTTGGATATGCTATAGG - Intronic
1027547432 7:79545794-79545816 CTGGATTTTGGCAAAGCTAGTGG + Intergenic
1027854492 7:83491935-83491957 CTATATTTTTGTTATGCTAGTGG - Intronic
1028003089 7:85526220-85526242 CTACATTTGGTCTATCTTAGTGG - Intergenic
1028290197 7:89056239-89056261 CTACATTTATCCTATGCTACAGG - Intronic
1029815005 7:103084687-103084709 CTACCTTTTGGCTTTGCTTATGG + Intronic
1030023389 7:105298111-105298133 CTATATTTTGGTTGTGGTAGTGG - Intronic
1030766345 7:113414340-113414362 CTGCATTTTGGCTATGATCAGGG + Intergenic
1031694048 7:124826955-124826977 CTGCATTTTGGCCATGGTATAGG + Intronic
1032729525 7:134624744-134624766 TTAGATTTTAGCTATTCTAGTGG - Intergenic
1032750839 7:134839576-134839598 TTAAATTTTAGCTATTCTAGTGG + Intronic
1034346181 7:150386687-150386709 CCACATCTTTGCTCTGCTAGGGG + Intronic
1038376806 8:27048077-27048099 CTCCATTTTGGCAGTGCTGGTGG - Intergenic
1039255104 8:35710338-35710360 CAAAATTTTGGCTATGCAACTGG + Intronic
1040894872 8:52355384-52355406 CTACATTTTGGCTATGCTAGGGG - Intronic
1042777748 8:72452626-72452648 CTACAATGTAGCTATGCAAGGGG - Intergenic
1044329421 8:90899090-90899112 CAAAGTTTTGGCTATGCCAGTGG + Intronic
1046712470 8:117525456-117525478 TTACCTTTTGGCTCTGCTAATGG + Intronic
1055089617 9:72349334-72349356 CTACATTTTGTCCAAACTAGAGG - Intergenic
1057281773 9:93718110-93718132 CTTAATTTTAGCCATGCTAGTGG + Intergenic
1058588673 9:106537708-106537730 ATACATTTTGGCTATGTTGGAGG - Intergenic
1060136884 9:121166026-121166048 CTACTTTTTGGGAATGCTAATGG + Intronic
1061383178 9:130271622-130271644 CTACTTTTTGGCACTGGTAGTGG + Intergenic
1187246097 X:17554012-17554034 CTTCATTTTGGCCATTCTGGTGG + Intronic
1189157986 X:38779362-38779384 TTAAATTTTGGCTATTTTAGTGG + Intergenic
1190959057 X:55227540-55227562 CTGCATTGTGTCTATGCTATAGG + Intronic
1192986868 X:76409000-76409022 CTACAACTTGGCTAGGCTAATGG + Intergenic
1194071197 X:89328415-89328437 CAACAATTTGGCTATGCAGGAGG - Intergenic
1194838746 X:98713796-98713818 CTAGATTTTGGATTTGCTTGGGG + Intergenic
1195612672 X:106886409-106886431 TTAAATTTTGGCCATTCTAGAGG + Intronic
1195929225 X:110056715-110056737 TTATATTTTGGCCATGCTAGTGG + Intronic
1199730994 X:150632072-150632094 CTACATTATGGCTGTGCTCAGGG + Intronic
1200725428 Y:6664153-6664175 CAACAATTTGGCTATGCAGGAGG - Intergenic