ID: 1040894873

View in Genome Browser
Species Human (GRCh38)
Location 8:52355385-52355407
Sequence ACTACATTTTGGCTATGCTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 110}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040894873_1040894877 14 Left 1040894873 8:52355385-52355407 CCCTAGCATAGCCAAAATGTAGT 0: 1
1: 0
2: 1
3: 7
4: 110
Right 1040894877 8:52355422-52355444 TAGACAGAATGAGGACAAACAGG No data
1040894873_1040894878 18 Left 1040894873 8:52355385-52355407 CCCTAGCATAGCCAAAATGTAGT 0: 1
1: 0
2: 1
3: 7
4: 110
Right 1040894878 8:52355426-52355448 CAGAATGAGGACAAACAGGCTGG No data
1040894873_1040894876 5 Left 1040894873 8:52355385-52355407 CCCTAGCATAGCCAAAATGTAGT 0: 1
1: 0
2: 1
3: 7
4: 110
Right 1040894876 8:52355413-52355435 GCAAGAATGTAGACAGAATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040894873 Original CRISPR ACTACATTTTGGCTATGCTA GGG (reversed) Intronic
900731076 1:4260595-4260617 ACTGCCTTTTGTCTTTGCTATGG + Intergenic
910222363 1:84900135-84900157 CCTAGATATTGGCTTTGCTAAGG + Intergenic
913251455 1:116915102-116915124 ACTCCATTCTGTCTCTGCTAAGG + Intronic
920339808 1:205268737-205268759 ACTGCATTTTGGGGATGCTGTGG + Intronic
921089199 1:211827348-211827370 AATACATTGCAGCTATGCTATGG + Intronic
923411668 1:233716397-233716419 GCTACATTTTGGTTAAGCTTTGG - Intergenic
1080366904 11:31585007-31585029 ACTACATTTTAGGTATTTTAGGG + Intronic
1082755516 11:57072135-57072157 GCAACATTTTGGCTATGTTCAGG - Intergenic
1085433919 11:76481880-76481902 ACAACATTTGAGCTCTGCTAAGG + Intronic
1088464549 11:110120411-110120433 ACAGCATTTTGGCTACGCTCAGG + Intronic
1089688935 11:120174131-120174153 TCTTCATTTTGGCTCTGCTCAGG + Intronic
1093042180 12:14394604-14394626 ACTGCAGTCTGGCTGTGCTAGGG + Intronic
1093164852 12:15792335-15792357 ACTCCATGTTGGTTATGGTATGG - Intronic
1099001967 12:77188831-77188853 TTTACATTTTGGCAATACTAAGG + Intergenic
1099870250 12:88339044-88339066 ACTAAATTTTTGGTATGTTATGG + Intergenic
1100502358 12:95186055-95186077 ACTACATTTTGGGATTTCTAGGG - Intronic
1100910712 12:99358889-99358911 ACTACAGATAGGCTATCCTAGGG + Intronic
1108681284 13:52782807-52782829 ACTCCATTTTGTCTATCCCAGGG + Intergenic
1111864052 13:93745558-93745580 ACTACTTTTTGGCTTTACAATGG + Intronic
1111965362 13:94856508-94856530 TCTACATTTTGGTCCTGCTATGG - Intergenic
1115048644 14:29028889-29028911 ACAACATTTAAGCTCTGCTAAGG - Intergenic
1115494750 14:33992018-33992040 AGGACATTTTGGCTATGCAGGGG + Intronic
1117574442 14:57083844-57083866 ATTATATTTTGGGTATGCTGAGG + Intergenic
1121733492 14:96202504-96202526 ACTGCATTTTTGCTATGAGAAGG - Intergenic
1123975227 15:25547240-25547262 ACTTCATTTTTGCCATTCTAGGG + Intergenic
1127099439 15:55550308-55550330 ACTACATTTTTCTTTTGCTAGGG + Intronic
1132042861 15:98539722-98539744 CCTACCTTTTGGCTTTGCTATGG - Intergenic
1133495506 16:6313514-6313536 ACTACATTCTGGCTGTCCAAGGG + Intronic
1135187093 16:20324328-20324350 GCTCTATTTTGGCTGTGCTAAGG + Intronic
1141295720 16:82767234-82767256 TCTGCATTTTGGCAATGCTTTGG - Intronic
1145299997 17:21627174-21627196 AACACATTTTGGTTATGCAAAGG + Intergenic
1146924317 17:36733515-36733537 AATGCATTCTGGCTGTGCTATGG + Intergenic
1152115462 17:78384138-78384160 ACTTCCTTTTGGCTAAGCCAAGG + Intronic
1152463552 17:80453751-80453773 CTTACATTTTGGCTTTGCCATGG + Intergenic
1152686980 17:81699168-81699190 ACTACTTTTTGTGTATTCTAGGG - Intronic
1157152458 18:45231747-45231769 ACTTCAGTTATGCTATGCTATGG + Intronic
1158068049 18:53437261-53437283 ACTACCTGTTGGGTATGTTAGGG - Intronic
1158404085 18:57146079-57146101 ACTACCTTTAAGCTATGTTACGG + Intergenic
1159569188 18:70092432-70092454 ACTACATTTTGTCTACATTATGG - Intronic
1159747680 18:72258720-72258742 ACAACATTTTGGCTAATTTAAGG - Intergenic
1164098452 19:22032805-22032827 GCTCCCTTTTGGCAATGCTAAGG + Intergenic
1167815296 19:51875403-51875425 ACTAGTTTTTGACTATGCCAGGG - Intronic
925999614 2:9319635-9319657 ACTACTTTTTGGCTTTTCAATGG - Intronic
928526414 2:32146201-32146223 AGAACGTTTTGGCTATTCTAAGG + Intronic
930407933 2:50984731-50984753 ACTACATTTTGGCTAAAAAAGGG - Intronic
932076010 2:68663554-68663576 ACTTGATTTTGGCTTTTCTAGGG - Intergenic
936329476 2:111535345-111535367 ACTACCTTTTGCCTATGGGAAGG - Intergenic
941515072 2:166463602-166463624 AATACATTTTGGCTATATTTTGG - Intronic
942662939 2:178285433-178285455 ATAACATTTTGGCTATTTTAAGG - Intronic
943009175 2:182425734-182425756 ACTACATGTTAGCAATGTTAAGG - Intronic
944946386 2:204691374-204691396 ACTAAATTTTGCCTATCCTAGGG + Intronic
1176650608 21:9543319-9543341 AACACATTTTGGTTATGCAAAGG + Intergenic
1177951642 21:27545139-27545161 ACTGCATTATGTCTATGCTTGGG + Intergenic
949583419 3:5413152-5413174 ACAACATTTGAGCTCTGCTAAGG + Intergenic
952144874 3:30521263-30521285 AAAAAATTTTAGCTATGCTATGG - Intergenic
963139573 3:141936499-141936521 ATTAGAATTTTGCTATGCTATGG + Intergenic
963853834 3:150234038-150234060 CCTACATTCTGGCTCTGTTATGG + Intergenic
966028556 3:175316771-175316793 ACTACATTTTGAACATGCTGAGG - Intronic
972030430 4:34450603-34450625 ACATCATTTTGGATATTCTAAGG - Intergenic
972852205 4:43064180-43064202 ACTAAATTATGGCTATGGTATGG + Intergenic
976120390 4:81774258-81774280 ACTACATTATGGCTATTTTATGG + Intronic
976680582 4:87751786-87751808 ACTACATTTTTTCCATGCTTTGG + Intergenic
978636669 4:110816724-110816746 ACAACATTTTGAATTTGCTAAGG + Intergenic
980513037 4:133818756-133818778 AAAACATTTTGCCTATGATATGG + Intergenic
980767980 4:137332849-137332871 ATTACATTTTTACTATACTATGG + Intergenic
983860631 4:172701584-172701606 GTTACACTTTAGCTATGCTAGGG + Intronic
987629800 5:20454871-20454893 ACTACATTTTGTCTAGGAAAGGG + Intronic
989474465 5:41857932-41857954 ACTATATTCTGGCTTTACTATGG - Intronic
989713227 5:44426952-44426974 ACTCAATTTTGGGTATTCTATGG + Intergenic
992746810 5:79828327-79828349 ACTATATTTTTTCTATTCTAAGG + Intergenic
993113964 5:83696429-83696451 AAAACATTTTGGCTATTCCAGGG - Intronic
994286760 5:97978765-97978787 GCTACATTTTGGCTGTTCTGGGG + Intergenic
996949774 5:129111499-129111521 AGGATATTTTGGCTATGCAAGGG + Intronic
999012839 5:148061329-148061351 TCTCCATTTGGGCTAGGCTAGGG + Intronic
1009840842 6:69072830-69072852 ACAGCATTTTGGCTATGCTGAGG + Intronic
1010249928 6:73696665-73696687 GCCACACTTTGGCAATGCTAAGG - Intronic
1010997761 6:82552691-82552713 AGTACATTTTGGCTTTGGTGAGG + Intergenic
1011656378 6:89555682-89555704 AGTACCTTTTGGCCAAGCTAGGG + Intronic
1015168898 6:130229185-130229207 ACTACATCTGGGCCATGCTTGGG - Intronic
1016475451 6:144422140-144422162 ACAACATTTTGGCTCTTCTGAGG + Intronic
1020836436 7:13157698-13157720 CCAACATTTTGCCTATGCCATGG - Intergenic
1025277287 7:57594274-57594296 AACACATTTTGGTTATGCAAAGG + Intergenic
1027167019 7:75842045-75842067 CTGACAATTTGGCTATGCTAAGG - Intergenic
1028449160 7:90961236-90961258 ACTATATTTTAGTTATGCAAAGG - Intronic
1029917090 7:104221760-104221782 ATTACATTTTGCCTCTGCTTTGG + Intergenic
1030766344 7:113414339-113414361 GCTGCATTTTGGCTATGATCAGG + Intergenic
1030862663 7:114655864-114655886 GGTACCTTTTGGCCATGCTATGG + Intronic
1035958061 8:4105017-4105039 ACTACATTATAGAAATGCTAAGG + Intronic
1040742159 8:50589847-50589869 AATACCTTCTGGCTCTGCTAAGG - Intronic
1040881759 8:52212788-52212810 AGAACATTTTGGCTCTACTAAGG + Intronic
1040894873 8:52355385-52355407 ACTACATTTTGGCTATGCTAGGG - Intronic
1041409525 8:57537671-57537693 AATAAATTTTGGTTATGTTAAGG - Intergenic
1042650318 8:71033455-71033477 GCTACATTGTGGCAGTGCTATGG + Intergenic
1042777749 8:72452627-72452649 ACTACAATGTAGCTATGCAAGGG - Intergenic
1044568955 8:93697075-93697097 AGGGCATTTTGGCCATGCTAAGG - Intergenic
1048145774 8:131841625-131841647 ATTATATTTTGACTTTGCTAAGG - Intergenic
1051134660 9:13905599-13905621 CCAAAATTTTTGCTATGCTATGG - Intergenic
1052434845 9:28413274-28413296 ATTTAATTTTGGATATGCTAGGG + Intronic
1055893262 9:81145758-81145780 AGTACACTTTGGCTTTGCCAAGG - Intergenic
1056749560 9:89337892-89337914 ACTAGAATTTGGCTAAGCTGGGG - Intronic
1056854156 9:90110732-90110754 ACTACTTTGGGGATATGCTATGG + Intergenic
1057607549 9:96511230-96511252 ACTAAATGTTGGATATGCTTTGG - Intronic
1058260676 9:102826623-102826645 ACTCCATTTTGGCTATGCTTTGG - Intergenic
1058705580 9:107635562-107635584 AATACATGTTGGGAATGCTATGG + Intergenic
1203628348 Un_KI270750v1:46872-46894 AACACATTTTGGTTATGCAAAGG + Intergenic
1186007807 X:5093719-5093741 ACAACATTTTGGGTCTTCTATGG - Intergenic
1186133842 X:6497735-6497757 ACTACATTTTGCATATGATAAGG - Intergenic
1187816077 X:23233168-23233190 ACTACATTCTGTTGATGCTATGG + Intergenic
1190546969 X:51537731-51537753 AGTATATTTTGGCTGTACTATGG + Intergenic
1191851990 X:65592029-65592051 GCTACAATCTGGCTATGCTTGGG - Intronic
1194790341 X:98140351-98140373 ACCACATTTTGGGAATTCTAGGG - Intergenic
1194838745 X:98713795-98713817 ACTAGATTTTGGATTTGCTTGGG + Intergenic
1196632507 X:117959289-117959311 ACTTCAATTTGGTGATGCTAAGG + Intronic
1196771090 X:119294181-119294203 ACTACGTTTTAACTATTCTAGGG + Intergenic
1197116450 X:122839216-122839238 AATACATTTTAGCTATGCAATGG + Intergenic
1197289279 X:124635787-124635809 AATACATTTAGCCTATTCTAAGG - Intronic
1199240248 X:145539833-145539855 GCTAACTTTTGGCTAAGCTATGG + Intergenic
1199730993 X:150632071-150632093 GCTACATTATGGCTGTGCTCAGG + Intronic
1201498630 Y:14617617-14617639 ACAGCATTTGAGCTATGCTAAGG - Intronic