ID: 1040894875

View in Genome Browser
Species Human (GRCh38)
Location 8:52355396-52355418
Sequence TCTTGCAAACAACTACATTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 336
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 317}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040894875_1040894879 24 Left 1040894875 8:52355396-52355418 CCAAAATGTAGTTGTTTGCAAGA 0: 1
1: 0
2: 0
3: 18
4: 317
Right 1040894879 8:52355443-52355465 GGCTGGTATGTTCTCATTTGTGG No data
1040894875_1040894877 3 Left 1040894875 8:52355396-52355418 CCAAAATGTAGTTGTTTGCAAGA 0: 1
1: 0
2: 0
3: 18
4: 317
Right 1040894877 8:52355422-52355444 TAGACAGAATGAGGACAAACAGG No data
1040894875_1040894876 -6 Left 1040894875 8:52355396-52355418 CCAAAATGTAGTTGTTTGCAAGA 0: 1
1: 0
2: 0
3: 18
4: 317
Right 1040894876 8:52355413-52355435 GCAAGAATGTAGACAGAATGAGG No data
1040894875_1040894878 7 Left 1040894875 8:52355396-52355418 CCAAAATGTAGTTGTTTGCAAGA 0: 1
1: 0
2: 0
3: 18
4: 317
Right 1040894878 8:52355426-52355448 CAGAATGAGGACAAACAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040894875 Original CRISPR TCTTGCAAACAACTACATTT TGG (reversed) Intronic
900500155 1:3000414-3000436 CCTTTCTAACAACTAGATTTCGG - Intergenic
901560930 1:10069959-10069981 TCTTACAGACAGCTAAATTTAGG - Intronic
901581245 1:10245589-10245611 ACTTGGAAAAAAATACATTTAGG + Intronic
902136744 1:14313002-14313024 TGTTTCAAGCTACTACATTTTGG + Intergenic
907143453 1:52210571-52210593 TATTTTAAACCACTACATTTTGG - Intronic
907716084 1:56927486-56927508 TTCTGCAAACAAATGCATTTTGG - Intergenic
907945966 1:59137026-59137048 TGTTTTAAACCACTACATTTTGG - Intergenic
908148697 1:61276861-61276883 TTTTGCAAACAAGTCCTTTTAGG + Intronic
909556325 1:76958365-76958387 TCCTCCAAACAACTACATAGCGG - Intronic
910824031 1:91386563-91386585 TGTTTTAAACTACTACATTTTGG + Intronic
911191497 1:94953275-94953297 TGTTTTAAACTACTACATTTTGG - Intergenic
911672165 1:100619681-100619703 TCTTCCAAGCTACTAAATTTTGG + Intergenic
911889600 1:103351403-103351425 ACCTGCAAACACCTTCATTTTGG - Intergenic
912309603 1:108607001-108607023 CATTGCAACCAACTAGATTTAGG - Intronic
913294521 1:117305793-117305815 TCTTGCAAGCCACTAAGTTTTGG + Intergenic
914416610 1:147489464-147489486 TTTTGTTAACAAATACATTTAGG - Intergenic
914838042 1:151224561-151224583 TCCTTCAAACAACTACAGTGAGG + Intronic
915879046 1:159645963-159645985 TGTTACAAAGACCTACATTTGGG - Intergenic
917339588 1:173961418-173961440 TCTTCCAAATAGCTAAATTTAGG + Intronic
918489306 1:185063600-185063622 TGTTTCAAATTACTACATTTTGG - Intronic
918623337 1:186630222-186630244 TCTTTCAGACAACTTCAATTTGG - Intergenic
918797509 1:188921326-188921348 CTTTGGAAACAACTACATTTAGG - Intergenic
920737919 1:208552067-208552089 TCATGCAAATAATCACATTTTGG + Intergenic
922444269 1:225683448-225683470 CCTAGCAAACAAATACACTTTGG - Intergenic
923060629 1:230469583-230469605 TGTTTCAAACAACTAACTTTTGG + Intergenic
1064263712 10:13807172-13807194 ACATGCAAACAAAGACATTTTGG - Intronic
1065529140 10:26651323-26651345 TCATGAAAACAACTAAATCTTGG + Intergenic
1065711033 10:28518273-28518295 TATTTCAAACAACCAAATTTTGG + Intergenic
1066441775 10:35446468-35446490 TCTTGCACACAAATGCATTCTGG - Intronic
1066538825 10:36421855-36421877 TCTAGAAAGCATCTACATTTTGG - Intergenic
1067399191 10:45955578-45955600 TATTTCAAATAAATACATTTTGG - Intergenic
1067867509 10:49924794-49924816 TATTTCAAATAAATACATTTTGG - Intronic
1068359559 10:55959014-55959036 TCTAGCAATCAAATACATTCTGG - Intergenic
1068838036 10:61577304-61577326 TCTTGAAAGCTACTACATGTTGG + Intergenic
1069155502 10:65025185-65025207 TTTTCCAAATAACTAGATTTGGG + Intergenic
1071272066 10:84017069-84017091 TCTTGCAAATAACTAAAGCTAGG + Intergenic
1071573185 10:86709107-86709129 TTTTACAAACAAATACAATTGGG + Intronic
1073752025 10:106539718-106539740 TATTCCAAACAACTACTGTTAGG + Intergenic
1074609664 10:115009320-115009342 TCTGGGAAACAAGGACATTTAGG - Intergenic
1074964783 10:118480670-118480692 TTTTTCAAACAACTAAATCTTGG - Intergenic
1075541322 10:123316859-123316881 TCATGCAAACTTCTACCTTTGGG - Intergenic
1075994509 10:126866152-126866174 TCTTGCCAACACCTTGATTTTGG + Intergenic
1076457508 10:130610967-130610989 TCTGGCAAAGCACTACAATTGGG - Intergenic
1079280056 11:19079227-19079249 TCTTTAAAACAAATACCTTTGGG - Intergenic
1079359080 11:19755520-19755542 TCCTGCCAACAACCAGATTTTGG - Intronic
1079368421 11:19829613-19829635 TCTTGCAAATGACAACACTTAGG + Intronic
1079399909 11:20098419-20098441 TTTTACAATCAAATACATTTGGG - Intronic
1079705789 11:23616164-23616186 TTTTTCAAACAACTAGCTTTTGG + Intergenic
1079845023 11:25454621-25454643 GCTTATAAACAAATACATTTTGG - Intergenic
1080423050 11:32129414-32129436 TCTTTCAAAGAACTATCTTTTGG - Intergenic
1081057296 11:38426067-38426089 TCTTGAACACAGCTACATTCAGG - Intergenic
1083371128 11:62182247-62182269 TCTTTCAAATAACGAAATTTTGG + Intergenic
1085873785 11:80382525-80382547 TCTTGGAAACTGCTACTTTTAGG + Intergenic
1087535608 11:99441283-99441305 TCTTTTAAACAATTACATATGGG + Intronic
1088331051 11:108652303-108652325 ACTTGCAAACAAGTATAATTTGG - Intergenic
1088839587 11:113613203-113613225 TTTTTAAAACAATTACATTTAGG + Intergenic
1090366382 11:126210195-126210217 TCTGGAAAACAACTTCATTGGGG + Intronic
1092035309 12:5329378-5329400 TCTGGGTAACAATTACATTTGGG + Intergenic
1093016508 12:14160726-14160748 TACTTCAAAAAACTACATTTAGG + Intergenic
1093632651 12:21428085-21428107 TTTGAGAAACAACTACATTTAGG + Intergenic
1094019291 12:25897179-25897201 TCTTGCAAAAAACCAATTTTAGG - Intergenic
1094559128 12:31533676-31533698 ACATGCATACAACTACATTGTGG - Intronic
1096052006 12:48618531-48618553 ACTGGCAAACATCTTCATTTAGG - Intergenic
1097255513 12:57670805-57670827 TCTTCCAAACAACCAGACTTTGG - Intergenic
1098163072 12:67666131-67666153 TCTTGCAAACACTTCCAGTTGGG - Intergenic
1099587369 12:84535559-84535581 TTTTACTAACAGCTACATTTAGG + Intergenic
1099874613 12:88389661-88389683 TCTTGCAAAGAACTCCCATTAGG - Intergenic
1100473133 12:94911758-94911780 TTTAGCAATCAACTGCATTTTGG - Intronic
1100902632 12:99259991-99260013 TATTACAAAGAAATACATTTTGG - Intronic
1101382360 12:104225128-104225150 TCTAGAAAACAACTCCATATGGG - Intronic
1107906496 13:45065927-45065949 TCTAGCAAACAACAATAATTTGG + Intergenic
1108156926 13:47594802-47594824 TGTTTTAAACCACTACATTTTGG - Intergenic
1108808877 13:54195614-54195636 TTTTGCAAACAACAGCATGTAGG - Intergenic
1109629267 13:65023080-65023102 TTTGGTAAACAACTACATTGAGG - Intergenic
1109948647 13:69472123-69472145 TCTAGAAAACTAATACATTTTGG - Intergenic
1110080001 13:71297865-71297887 TCTTTTAAACCAATACATTTAGG - Intergenic
1110755250 13:79165647-79165669 TTTTCCAAAGAACCACATTTTGG - Intergenic
1110818068 13:79882988-79883010 TCTTGGAAACTGCAACATTTGGG + Intergenic
1111921631 13:94417805-94417827 TCTTTCAAACCACCAGATTTTGG - Intergenic
1112632682 13:101179824-101179846 TCTTGCCGACAACTCAATTTTGG - Intronic
1112637364 13:101230059-101230081 TATTGCATACAACTACCTTCAGG + Intronic
1112873694 13:104007699-104007721 TCTGCCAAACACCTACCTTTAGG - Intergenic
1112895466 13:104294391-104294413 TTTTTCAAACCACTACAATTTGG + Intergenic
1113148128 13:107231577-107231599 TCTATGAACCAACTACATTTTGG + Intronic
1113839746 13:113352011-113352033 GCTTACAAAAAACTAGATTTGGG + Intronic
1114912153 14:27213827-27213849 TAGTGCAAACGACTCCATTTTGG + Intergenic
1115243160 14:31269420-31269442 TCTTGCCAACACCTTGATTTTGG - Intergenic
1116077989 14:40136487-40136509 TCTTTCAAACAACAAAGTTTTGG + Intergenic
1116716601 14:48434667-48434689 AATAGCAAACATCTACATTTAGG - Intergenic
1117033525 14:51702421-51702443 TCTTGCAAATAATTGTATTTTGG + Intronic
1118145939 14:63136820-63136842 GTTTGCAAAAAACGACATTTGGG - Intergenic
1118154402 14:63224720-63224742 TCTTCCAAATAACTAAATTCTGG - Intronic
1118487139 14:66224833-66224855 TCTTGGAAAATACAACATTTGGG - Intergenic
1122053399 14:99075452-99075474 CCCTGCAAAGAACAACATTTGGG + Intergenic
1122497499 14:102169252-102169274 TCTTTCACAGAACCACATTTGGG - Intronic
1123400662 15:19981815-19981837 TCTTGCTAACAAACACATCTTGG - Intergenic
1124502305 15:30239758-30239780 GTTTGCAAACAAAAACATTTTGG + Intergenic
1124741258 15:32298893-32298915 GTTTGCAAACAAAAACATTTTGG - Intergenic
1125401540 15:39309881-39309903 TTTAGCAGACATCTACATTTGGG - Intergenic
1126570811 15:50148400-50148422 TATTGGCAACACCTACATTTTGG - Intronic
1127938038 15:63662530-63662552 TCTTGTAAATACCTCCATTTAGG - Intronic
1130032333 15:80327387-80327409 TGTTTAAAACCACTACATTTTGG - Intergenic
1130814098 15:87412423-87412445 TGTTGCAAACAATAACAATTTGG + Intergenic
1131361042 15:91790921-91790943 GCTTGCTAACAACTTCAATTTGG + Intergenic
1132130945 15:99278693-99278715 TCTTTTAAATCACTACATTTGGG - Intronic
1132278484 15:100591540-100591562 TAATGCAAGCAACTCCATTTTGG - Intronic
1133553398 16:6881397-6881419 TCTTGCCAACACCTTCATTCTGG - Intronic
1137437582 16:48469627-48469649 TCTTGCAAAAAACCACCTCTTGG + Intergenic
1139011421 16:62639258-62639280 TTTTGCAAACCTCTAAATTTTGG - Intergenic
1139051710 16:63131290-63131312 TATTTCAAAAAACTTCATTTTGG + Intergenic
1139255643 16:65539498-65539520 TCTTGCAGACAACACCTTTTGGG + Intergenic
1140328281 16:74027329-74027351 TCTTGCAAACCTTTACATTAAGG + Intergenic
1141043545 16:80693285-80693307 TCTTCCAAACAACTTTATTGAGG - Intronic
1142516500 17:433571-433593 TCTTTTAAACATTTACATTTAGG + Intergenic
1144302814 17:13938843-13938865 TCTTGGAAAATACAACATTTGGG - Intergenic
1144410270 17:14993989-14994011 TTTTGCACATAACCACATTTGGG + Intergenic
1146614267 17:34340225-34340247 TCTTTCAAAGAACCACCTTTTGG + Intergenic
1148915120 17:50970194-50970216 CCTTTCAAACAAATACATTTTGG + Intronic
1149010114 17:51847533-51847555 TCATGCAAAGAAGTGCATTTTGG - Intronic
1149368124 17:55965948-55965970 TCTTGGAGACAAATATATTTTGG - Intergenic
1149463174 17:56850443-56850465 TCTTGCAAATAGATATATTTAGG + Intronic
1150357937 17:64504581-64504603 TTTTGCAAATAACTCAATTTTGG - Intronic
1152670988 17:81606120-81606142 TCTTGAAAACTACTTTATTTTGG - Intronic
1153009659 18:526653-526675 ACTTTCAAACAACCACATCTCGG + Intergenic
1156669907 18:39455638-39455660 TCTTTTAAACCACTATATTTTGG + Intergenic
1156703252 18:39849788-39849810 TCTTGCTGACACCTTCATTTCGG + Intergenic
1156988602 18:43379205-43379227 TCTTCCAACCAACTAAAATTGGG - Intergenic
1157036028 18:43975341-43975363 TGTTGAAAGCAACTCCATTTAGG - Intergenic
1163858894 19:19729677-19729699 CCTTGAAAACAAGTATATTTAGG - Intronic
1167296181 19:48651428-48651450 CCTTGCCAACACCTTCATTTTGG + Intergenic
1168506198 19:56937149-56937171 TCTTGGAAACAACTTAATATTGG + Intergenic
926442349 2:12903125-12903147 TCTGGCTAACAATTACAATTAGG - Intergenic
926644580 2:15275371-15275393 TCTTGAAAATAATTACATGTTGG - Intronic
927950614 2:27166057-27166079 TATGCCAAACAAATACATTTTGG - Intergenic
928285083 2:29983054-29983076 TGTTTCAAGCCACTACATTTTGG + Intergenic
928723311 2:34144459-34144481 TCTTGCCAACACCTTGATTTTGG + Intergenic
930991659 2:57663513-57663535 CATTGGAAACAACTACATTTTGG - Intergenic
931918011 2:66980234-66980256 TCTTACAAATATCTGCATTTAGG + Intergenic
932025876 2:68132005-68132027 TGTTTGAAACAATTACATTTAGG - Intronic
932616885 2:73237681-73237703 TCATGTAAACCCCTACATTTGGG - Intronic
936838220 2:116734306-116734328 TATTGAAAACAAATACATTGAGG + Intergenic
937643970 2:124244970-124244992 TTTTGCAACCAACTATATTTAGG - Intronic
939500230 2:142975116-142975138 TTTTGGAAAAAACAACATTTAGG - Intronic
939844860 2:147230602-147230624 TCTTGCAAACCATTCCATGTAGG - Intergenic
940192190 2:151053686-151053708 TCCTGCAAACAAATACACTGGGG + Intergenic
940750306 2:157619793-157619815 TCTTGCAAATAAATAGCTTTTGG - Intronic
940811292 2:158245558-158245580 TCTTGCTAAAATCTCCATTTTGG + Intronic
941921794 2:170858532-170858554 TGTTACAAATAATTACATTTGGG - Intronic
943403280 2:187444516-187444538 TTTTGCAAACAATAATATTTTGG + Intronic
943473934 2:188331384-188331406 TCTTTCAAACCCCTACTTTTTGG + Intronic
943508343 2:188791900-188791922 TATTTTAAACAACTAAATTTTGG - Intergenic
943921650 2:193714252-193714274 TCATGAAAACGACTCCATTTTGG + Intergenic
944631947 2:201635833-201635855 TCCTGCAGACAACTTGATTTTGG + Intronic
946626933 2:221622994-221623016 TAATGCAAACATCCACATTTAGG + Intergenic
947457698 2:230270596-230270618 TATTGCAAACAACTCCACTTTGG + Exonic
947468036 2:230371608-230371630 TATTGCAAACAACTCTACTTTGG + Exonic
1168733329 20:106698-106720 TCTTTCAAAAAACCACCTTTTGG - Intergenic
1169902008 20:10562569-10562591 TCTTGGAAAATACAACATTTGGG + Intronic
1169997828 20:11578205-11578227 TCTTGTAAGCCACTAAATTTGGG - Intergenic
1170077863 20:12439257-12439279 TGTTGTAAGCCACTACATTTTGG + Intergenic
1171563612 20:26154739-26154761 GCTTGCCTACAACTACAATTTGG + Intergenic
1177300039 21:19231959-19231981 TCCTCCCAACAACTACACTTAGG + Intergenic
1177627127 21:23676559-23676581 GCTTACAAACAAATACAATTAGG + Intergenic
1178906229 21:36639242-36639264 TCCTGCCAACACCTTCATTTTGG - Intergenic
1180094832 21:45551101-45551123 TCTTTCAAGGAACTACCTTTTGG + Intergenic
1180623291 22:17176514-17176536 TGTTTCAAACCACTACGTTTTGG + Intergenic
1182756384 22:32683005-32683027 TCTTGAAAATATCTACATTAGGG + Intronic
1182892885 22:33833518-33833540 CCTTGCTAACAACTTCATCTTGG + Intronic
1183044232 22:35207028-35207050 TATTGATAACAACTACATTGTGG - Intergenic
1183330735 22:37219703-37219725 TATTGTAAGCCACTACATTTTGG - Intergenic
1184013661 22:41769039-41769061 TTTTGCAAAAAAGTACAATTGGG - Intronic
949569226 3:5275795-5275817 TCCTGCCAACAACTTGATTTGGG - Intergenic
949832722 3:8233102-8233124 TCCTGCAAAAAACTACACATTGG + Intergenic
950003920 3:9679206-9679228 TCTTGCAAACACCTGCATTGGGG - Intronic
951066055 3:18266860-18266882 TCTTGCAGACAACTATAGCTTGG + Intronic
951933346 3:27994573-27994595 TGTTACAAACAAGGACATTTAGG - Intergenic
951958758 3:28290808-28290830 TCTTTTAAGCCACTACATTTTGG - Intronic
952003385 3:28811110-28811132 TCTTGGAAAATACAACATTTGGG + Intergenic
954464683 3:50647455-50647477 TCTTATAACCAACAACATTTGGG + Intronic
955345859 3:58161395-58161417 TCTAGTAAACATCTCCATTTGGG - Intronic
955369803 3:58341213-58341235 CCTTGCTGACAACCACATTTAGG + Intronic
955576154 3:60366130-60366152 TCTTGCATAGAACTGAATTTTGG + Intronic
956100802 3:65766180-65766202 TCTTCAAAAAAACTTCATTTGGG + Intronic
958018990 3:87975304-87975326 TCTTGCAAAAATCCAAATTTTGG + Intergenic
958172270 3:89953181-89953203 TCATGAAAACAACAACTTTTTGG + Intergenic
958918665 3:100078444-100078466 TGTTTTAAACGACTACATTTTGG - Intronic
959321376 3:104879494-104879516 TCATGCAATAAAATACATTTAGG + Intergenic
959825316 3:110787747-110787769 TCTTTCAAAAAACCAAATTTTGG + Intergenic
959941397 3:112085677-112085699 TCCTGGTAACAACTACATTTAGG + Intergenic
960520111 3:118644839-118644861 TCTTGGAAACAACACCTTTTGGG - Intergenic
960556102 3:119032516-119032538 TCTTGCCCCCAACTACTTTTTGG + Intronic
960564166 3:119116749-119116771 TCTTGCAAATAACACCATTATGG + Intronic
961629501 3:128285630-128285652 TTTTGAAAACAACTACAGATTGG - Intronic
961928860 3:130512307-130512329 TCTGGCTCACAACTACATGTGGG - Intergenic
962869101 3:139472764-139472786 TGTTCCAAACCACTACGTTTTGG + Intronic
963516867 3:146319918-146319940 TCTTTCAAAGAACCAAATTTTGG - Intergenic
963849642 3:150198198-150198220 TTTTTTAAAAAACTACATTTTGG + Intergenic
964852225 3:161106786-161106808 TTTTGCAAGCAACTATATTTTGG - Intronic
965279115 3:166725494-166725516 TATGTCAAAGAACTACATTTGGG - Intergenic
966174565 3:177121982-177122004 TCCTACAAATAAATACATTTAGG + Intronic
968558046 4:1259902-1259924 TCTTTCAAAGAACTAACTTTTGG + Intergenic
968687855 4:1973565-1973587 TCTTGCAGAGAACCACATTCTGG + Intronic
970376530 4:15463368-15463390 TATTTTAAACCACTACATTTTGG - Intergenic
970711612 4:18870320-18870342 TATGGCAAAGAAATACATTTTGG - Intergenic
970744178 4:19275406-19275428 TATTACAATCTACTACATTTTGG + Intergenic
970900849 4:21157884-21157906 TTTTTAAAAGAACTACATTTTGG - Intronic
971487518 4:27175509-27175531 TTTTTTAAAAAACTACATTTGGG + Intergenic
971678877 4:29671388-29671410 TCCTGTAAACACCTTCATTTAGG - Intergenic
971812195 4:31440449-31440471 TATTGGAAACAACTGAATTTTGG + Intergenic
974279602 4:59775330-59775352 TCTTGCAGACTACTCAATTTGGG + Intergenic
974415540 4:61601854-61601876 TCTTTCAAACTACTATACTTAGG + Intronic
975425982 4:74228107-74228129 TTTTCCAAAAAATTACATTTGGG + Intronic
976804433 4:89030224-89030246 TCTTTGAAACAACAACATTTAGG + Intronic
976939845 4:90686371-90686393 TCTAGCAAACACCTCCAGTTAGG - Intronic
978242416 4:106532822-106532844 GCTTGCAAATAACAATATTTAGG + Intergenic
978290611 4:107135053-107135075 ATTTGCAAACAACTTCAATTTGG + Intronic
979224890 4:118273513-118273535 TGTTGTAAGCTACTACATTTTGG - Intergenic
979284043 4:118901113-118901135 ACTTGCAAAAAAATACATTTTGG + Intronic
979884032 4:126001621-126001643 TCTTTCAAAACACTATATTTAGG - Intergenic
980211170 4:129790075-129790097 TATTCCAAACCACTAAATTTTGG + Intergenic
980493313 4:133559227-133559249 ACTTGCAAATAATTATATTTTGG + Intergenic
980677129 4:136099939-136099961 TCATTCAAACCAGTACATTTTGG - Intergenic
980888443 4:138788299-138788321 TCTTTTAAGCCACTACATTTTGG - Intergenic
982660599 4:158201875-158201897 TCTTTTAACCCACTACATTTTGG + Intronic
986482017 5:8199034-8199056 TCTTTTAAGCCACTACATTTTGG - Intergenic
986909542 5:12537358-12537380 TCTTGCAAAGAACTAGCTCTTGG - Intergenic
987604905 5:20121216-20121238 TCTTGCAAATAACTGCTTTTTGG - Intronic
989711139 5:44398788-44398810 CCTTACAAACAATTTCATTTTGG - Intergenic
991484289 5:67118451-67118473 TCTTGCAAACACCTAGACATAGG - Intronic
994533242 5:100993126-100993148 TCTTGGAAAAGACAACATTTGGG + Intergenic
996932021 5:128901250-128901272 TGTTGTAAACCACTACTTTTTGG - Intronic
997419976 5:133758696-133758718 TATTTCAAACAGCTAAATTTTGG - Intergenic
999172958 5:149610871-149610893 TGTTTCAAGCCACTACATTTTGG - Intronic
999668531 5:153937527-153937549 TCTTGGAAAAGACAACATTTGGG + Intergenic
999684060 5:154086716-154086738 TCTTCCAAACAACTATAATATGG + Intronic
999812736 5:155143149-155143171 TCCTGCAAACACCTCCCTTTAGG + Intergenic
1000659331 5:163919053-163919075 TGTTATAAACCACTACATTTTGG - Intergenic
1000803326 5:165756807-165756829 TCTTTCAAATAACTAGATTGAGG + Intergenic
1001147959 5:169201320-169201342 TCTTGCAAACATCTTCAGTGAGG - Intronic
1004448125 6:15721198-15721220 TCTTTCAAAGAACTAGCTTTTGG + Intergenic
1004510835 6:16283282-16283304 TGTTAAAAACAACAACATTTGGG - Intronic
1004787476 6:18985176-18985198 TCATACAAAAAACTATATTTAGG - Intergenic
1004877265 6:19968282-19968304 TCTTGTAAACCACTAAATTTTGG - Intergenic
1005157337 6:22821403-22821425 TTTTGCAAACTACAACACTTGGG - Intergenic
1007804083 6:44424906-44424928 TCTTAAAAACAAATACATCTTGG + Intronic
1007905503 6:45456204-45456226 TCATACATACAAATACATTTAGG - Intronic
1008156814 6:48025828-48025850 TCTTGCAAACAGCTCCAATGAGG - Intronic
1008630244 6:53357590-53357612 TGTTCCAAACCACTAGATTTTGG + Intergenic
1011067881 6:83348054-83348076 TCTTAAAAGCAAATACATTTGGG + Intronic
1011176530 6:84567459-84567481 TATTTCAAACCACTAAATTTTGG - Intergenic
1011408976 6:87046018-87046040 TGTTTAAAACTACTACATTTTGG + Intergenic
1011963943 6:93128885-93128907 TCCTCCAAACAACTATATTATGG + Intergenic
1012382524 6:98637507-98637529 TCTTAGAAACAAGGACATTTTGG + Intergenic
1012468903 6:99547914-99547936 ACTGGTAAACAACTACATGTGGG + Intronic
1013228225 6:108136666-108136688 TCTTGAAAACAACTACTACTAGG - Intronic
1013463344 6:110396581-110396603 TCTGGCAAGCATCTACACTTTGG + Intronic
1013840700 6:114389475-114389497 TCTTGCAAAAATGTACAATTAGG - Intergenic
1013944960 6:115711664-115711686 TGTTGAAAACCACTAAATTTTGG - Intergenic
1014450999 6:121581612-121581634 TCTTGCTAACATGTACATTTTGG + Intergenic
1014920117 6:127204364-127204386 TCCTGCAAAATACTACATTATGG + Intergenic
1016107631 6:140182129-140182151 GCTTGCAGACAACCACCTTTTGG - Intergenic
1016203599 6:141444213-141444235 TCTGACAAATAATTACATTTGGG - Intergenic
1016242489 6:141947109-141947131 CCTTTCAAATAACAACATTTTGG - Intergenic
1017980089 6:159393914-159393936 TCTTGGAAAATGCTACATTTGGG - Intergenic
1019161756 6:170073578-170073600 TCTTTCAAATAACTAGTTTTTGG + Intergenic
1022052331 7:26689241-26689263 TCTTGCAAAAAGCTAGAGTTAGG - Intronic
1024643022 7:51347126-51347148 TCTAACAAACAACTGCATATTGG + Intergenic
1028038978 7:86022983-86023005 TCTTGGGAACACTTACATTTTGG - Intergenic
1028190162 7:87839512-87839534 TCTGGAAAACAAGTAAATTTGGG + Intronic
1028952637 7:96654137-96654159 TTGTGCAAACAATGACATTTGGG + Intronic
1028960667 7:96746377-96746399 TCATGCATACAACTATGTTTCGG + Intergenic
1029251747 7:99241781-99241803 TCTAGAAAACAAATACCTTTTGG - Intergenic
1029913365 7:104179298-104179320 ACTTTTAAATAACTACATTTAGG - Intronic
1030396347 7:108991154-108991176 TATGGCAAATAAATACATTTTGG + Intergenic
1031571299 7:123363593-123363615 TCTTGAAAAAACCTACATCTTGG + Intergenic
1032146465 7:129386481-129386503 CTTTGAAAACAAATACATTTTGG + Intronic
1034038644 7:147852026-147852048 TTTTTCAAGCAACTATATTTTGG - Intronic
1035177508 7:157062309-157062331 TGTTTTAAACCACTACATTTTGG + Intergenic
1035956815 8:4089287-4089309 TCTTTCAAACATCTACAAGTTGG - Intronic
1036543774 8:9746540-9746562 CCTTGAAAACAACAATATTTTGG - Intronic
1037079891 8:14771669-14771691 GTTTGCAATCAAATACATTTGGG + Intronic
1039159991 8:34607310-34607332 TCTTGCATAAAACTATATGTTGG + Intergenic
1040894875 8:52355396-52355418 TCTTGCAAACAACTACATTTTGG - Intronic
1041614402 8:59888524-59888546 TCTTGCATAAAACTACTTTTGGG + Intergenic
1042281382 8:67060196-67060218 TCTTGAATAAAATTACATTTTGG + Intronic
1043099649 8:76025984-76026006 TCATCCAAAAAATTACATTTTGG + Intergenic
1043436880 8:80243754-80243776 TTTTGCAAACTATTATATTTTGG + Intergenic
1044139814 8:88636528-88636550 TCTAGCAAACTAATACATGTGGG + Intergenic
1044542017 8:93418867-93418889 TATTGCAAACACCACCATTTGGG - Intergenic
1045711357 8:104988264-104988286 TTTTGCAATCTACCACATTTGGG + Intronic
1045773060 8:105767858-105767880 TTTTTCAAACATCTAAATTTTGG - Intronic
1046176020 8:110575957-110575979 TCTTTCAAACTTCTAAATTTCGG - Intergenic
1046504883 8:115124682-115124704 TCCTCCCAACACCTACATTTAGG - Intergenic
1046507281 8:115152273-115152295 TGTTTCAACCCACTACATTTTGG - Intergenic
1047621029 8:126608161-126608183 ACTTTCAAACAACAACATATAGG + Intergenic
1048942501 8:139413841-139413863 TCTTTTAAACCACTACATTTTGG - Intergenic
1050676184 9:8056564-8056586 CATTGTAAACAACTAGATTTGGG - Intergenic
1051921157 9:22267046-22267068 TGTTGCAAATGACTAAATTTAGG - Intergenic
1053580918 9:39403435-39403457 TCTTGGAAAATGCTACATTTCGG - Intergenic
1053845411 9:42231489-42231511 TCTTGGAAAATGCTACATTTCGG - Intergenic
1054102504 9:60962239-60962261 TCTTGGAAAATGCTACATTTCGG - Intergenic
1054583855 9:66944630-66944652 TCTTGGAAAATGCTACATTTCGG + Intergenic
1054938742 9:70716811-70716833 TCTCCCAAACAAATACATTGGGG + Intronic
1054940433 9:70734804-70734826 TCTCCCAAACAAATACATTGGGG + Intronic
1055925537 9:81507107-81507129 TCTTACATACAACTGAATTTAGG - Intergenic
1058571924 9:106355927-106355949 TCTTTCAAAAAACTAACTTTTGG + Intergenic
1059964145 9:119597047-119597069 TATTGCAAACTGCTAAATTTGGG + Intergenic
1187105932 X:16241681-16241703 TCTTAAAAACAACAACATATAGG - Intergenic
1189671854 X:43419391-43419413 CCTCACCAACAACTACATTTGGG + Intergenic
1189783380 X:44537454-44537476 TCATCCAAAGAACTAAATTTAGG + Intronic
1190795131 X:53733986-53734008 CCTGGCATATAACTACATTTTGG - Intergenic
1191145993 X:57165885-57165907 TCTTGGAAAAAGCAACATTTGGG - Intergenic
1191920742 X:66254675-66254697 TTGTGCAAACAACTGCATTTAGG + Intronic
1193551733 X:82901723-82901745 TCTTTCAAACAACCACTTTTTGG - Intergenic
1194116643 X:89907566-89907588 TCTTGGAAATAACTCCATATTGG - Intergenic
1194789804 X:98133162-98133184 TCTTGCTAACAGATACATTAAGG - Intergenic
1194913923 X:99681801-99681823 TTTTGGACACAACTACATTTTGG + Intergenic
1194951606 X:100134079-100134101 TCTTTCAAAGAACCAGATTTTGG - Intergenic
1196874173 X:120142633-120142655 TCTTTCAGAGAACCACATTTTGG + Intergenic
1196991231 X:121330716-121330738 TCTTTAAAATACCTACATTTTGG - Intergenic
1197029463 X:121796593-121796615 ACTTACATACTACTACATTTAGG + Intergenic
1197296321 X:124723478-124723500 TCTTGCATAAAACTCCATCTAGG + Intronic
1197377736 X:125702640-125702662 TCTTTCAAACAACAAACTTTTGG + Intergenic
1197979882 X:132206038-132206060 TCTCTCAAAAAACTAAATTTAGG - Intronic
1199144900 X:144353272-144353294 TCTTCCAAACAGGTGCATTTTGG - Intergenic
1199454529 X:148013449-148013471 TTTGGGAAACAACCACATTTGGG - Intronic
1200469441 Y:3564738-3564760 TCTTGGAAATAACTCCATATTGG - Intergenic
1200697898 Y:6377177-6377199 TCTTGCACACAGCTTCTTTTGGG - Intergenic
1200700462 Y:6397896-6397918 TCTTGCACACATCTTCTTTTGGG - Intergenic
1200918590 Y:8593034-8593056 TCTTGCACACAACATCTTTTGGG + Intergenic
1200928927 Y:8679519-8679541 TCTTGCACACAGCTTCTTTTGGG - Intergenic
1201033650 Y:9766802-9766824 TCTTGCACACATCTTCTTTTGGG + Intergenic
1201036214 Y:9787522-9787544 TCTTGCACACAGCTTCTTTTGGG + Intergenic
1201412423 Y:13713484-13713506 TCTTGCAAAATGCAACATTTGGG + Intergenic
1201484796 Y:14481474-14481496 TATTGCAATCAACTTAATTTTGG - Intergenic
1202104646 Y:21350269-21350291 TGATGCAAACAACTATATTGTGG + Intergenic