ID: 1040894878

View in Genome Browser
Species Human (GRCh38)
Location 8:52355426-52355448
Sequence CAGAATGAGGACAAACAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040894868_1040894878 26 Left 1040894868 8:52355377-52355399 CCCCCAACCCCTAGCATAGCCAA 0: 1
1: 0
2: 1
3: 10
4: 172
Right 1040894878 8:52355426-52355448 CAGAATGAGGACAAACAGGCTGG No data
1040894871_1040894878 23 Left 1040894871 8:52355380-52355402 CCAACCCCTAGCATAGCCAAAAT 0: 1
1: 0
2: 0
3: 10
4: 99
Right 1040894878 8:52355426-52355448 CAGAATGAGGACAAACAGGCTGG No data
1040894872_1040894878 19 Left 1040894872 8:52355384-52355406 CCCCTAGCATAGCCAAAATGTAG 0: 1
1: 0
2: 0
3: 15
4: 116
Right 1040894878 8:52355426-52355448 CAGAATGAGGACAAACAGGCTGG No data
1040894874_1040894878 17 Left 1040894874 8:52355386-52355408 CCTAGCATAGCCAAAATGTAGTT 0: 1
1: 0
2: 0
3: 13
4: 202
Right 1040894878 8:52355426-52355448 CAGAATGAGGACAAACAGGCTGG No data
1040894870_1040894878 24 Left 1040894870 8:52355379-52355401 CCCAACCCCTAGCATAGCCAAAA 0: 1
1: 0
2: 0
3: 9
4: 137
Right 1040894878 8:52355426-52355448 CAGAATGAGGACAAACAGGCTGG No data
1040894875_1040894878 7 Left 1040894875 8:52355396-52355418 CCAAAATGTAGTTGTTTGCAAGA 0: 1
1: 0
2: 0
3: 18
4: 317
Right 1040894878 8:52355426-52355448 CAGAATGAGGACAAACAGGCTGG No data
1040894869_1040894878 25 Left 1040894869 8:52355378-52355400 CCCCAACCCCTAGCATAGCCAAA 0: 1
1: 0
2: 0
3: 9
4: 167
Right 1040894878 8:52355426-52355448 CAGAATGAGGACAAACAGGCTGG No data
1040894873_1040894878 18 Left 1040894873 8:52355385-52355407 CCCTAGCATAGCCAAAATGTAGT 0: 1
1: 0
2: 1
3: 7
4: 110
Right 1040894878 8:52355426-52355448 CAGAATGAGGACAAACAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040894878 Original CRISPR CAGAATGAGGACAAACAGGC TGG Intronic
No off target data available for this crispr