ID: 1040902782

View in Genome Browser
Species Human (GRCh38)
Location 8:52433946-52433968
Sequence GTAAAGCGCCATGGTGGGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 111
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 103}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040902782_1040902788 6 Left 1040902782 8:52433946-52433968 CCCTGCCCACCATGGCGCTTTAC 0: 1
1: 0
2: 0
3: 7
4: 103
Right 1040902788 8:52433975-52433997 CTGCTTGACCTCACCTGCCATGG No data
1040902782_1040902792 27 Left 1040902782 8:52433946-52433968 CCCTGCCCACCATGGCGCTTTAC 0: 1
1: 0
2: 0
3: 7
4: 103
Right 1040902792 8:52433996-52434018 GGCCTCTCCCTGCCTCTCGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040902782 Original CRISPR GTAAAGCGCCATGGTGGGCA GGG (reversed) Intronic
902210374 1:14900456-14900478 GTAAAGAGCTATGGTTGGCCGGG + Intronic
903657753 1:24959447-24959469 GGCAAGCGCCATAGTGGGCACGG + Intronic
904108720 1:28107917-28107939 TGAAACCGCCATGGTGGGGAAGG - Intergenic
905536982 1:38729870-38729892 GAAAAGTGCCCTGGTGGGCTGGG + Intergenic
912452168 1:109773939-109773961 GTAAAACACCATGTTGGGCCAGG - Intronic
918407136 1:184222515-184222537 GTAAGGGGCCAGAGTGGGCATGG - Intergenic
919092381 1:192991336-192991358 GTAAAGTGTCATGGTGGTCCTGG - Intergenic
919822529 1:201482142-201482164 GTGCAGCCCCACGGTGGGCAAGG - Intergenic
920518757 1:206606706-206606728 GGAAAGAGCGATGGTAGGCATGG - Intronic
924315367 1:242789933-242789955 GTCAAAAACCATGGTGGGCAGGG - Intergenic
1067741147 10:48896974-48896996 GCACAGCGCCAGGCTGGGCATGG + Intronic
1069655420 10:70084394-70084416 GTAAAGCATCTTGCTGGGCATGG + Intronic
1071176532 10:82932688-82932710 GTAAAAAGCCATGCAGGGCAGGG - Intronic
1071880881 10:89897313-89897335 GTAATGCTCAATGGTGGGCAAGG + Intergenic
1075258672 10:120944838-120944860 GCAAGGAGCCCTGGTGGGCAGGG - Intergenic
1075511188 10:123074082-123074104 GAAAGGCCCCATGGTGGGCCAGG + Intergenic
1077110054 11:858349-858371 GCACAGCCCCAGGGTGGGCAGGG - Intronic
1077142142 11:1029383-1029405 GGGTAGCGGCATGGTGGGCAGGG + Intronic
1078776022 11:14394219-14394241 GTAACGCCCCATGCTGGGCGCGG + Intergenic
1083140092 11:60714598-60714620 GTTGAGCGCCATGGTGGGAAGGG - Intronic
1084651091 11:70489971-70489993 GTAAAGCGGGAGGGTGGGCGGGG - Intronic
1084753786 11:71222010-71222032 GTGAAGCGCCCAGGTGAGCATGG + Intronic
1089749250 11:120638789-120638811 CTAAAGCGGCACGGTGAGCAAGG + Intronic
1091212314 11:133872641-133872663 GTAAAGGGCTATAGTTGGCAGGG - Intergenic
1091966096 12:4743139-4743161 GAAAAGTACCATAGTGGGCATGG - Intronic
1095085323 12:38053552-38053574 GTAAAGGGGCATGGGGGGCCGGG + Intergenic
1095406893 12:41876478-41876500 GGAGAGGGCCGTGGTGGGCATGG - Intergenic
1098030697 12:66250527-66250549 GTACAGAGCAGTGGTGGGCATGG - Exonic
1106235184 13:27855426-27855448 GTAAAGCGCTGTGGGTGGCAGGG - Intergenic
1106556505 13:30813338-30813360 GAAAAGCCCCATGGTTGCCAGGG - Intergenic
1111900618 13:94195291-94195313 GTAAGAAGCCATTGTGGGCATGG + Intronic
1120392314 14:83924469-83924491 GGAAGCAGCCATGGTGGGCATGG - Intergenic
1120537434 14:85714224-85714246 TCAAAGGGCCATTGTGGGCAGGG + Intergenic
1122707908 14:103632939-103632961 GTAAAGGGGCATGTTGGGAAGGG + Intronic
1128135564 15:65260750-65260772 GTAAAGCACCATGCTGGACACGG - Intronic
1132842803 16:1986446-1986468 GCACAGAGCCATGGGGGGCAGGG - Exonic
1134585189 16:15404203-15404225 GTAAAGCACCATGGTATGCCTGG + Intronic
1137499641 16:49000639-49000661 GAAAAGCACCATGGTGGTCTTGG - Intergenic
1145025117 17:19462496-19462518 TTAAAGCTCCAGGCTGGGCATGG - Intergenic
1150157503 17:62866419-62866441 GTAAAGTGCCCAAGTGGGCAGGG + Intergenic
1151993154 17:77591610-77591632 GTAAAGCCCCATGATCAGCACGG + Intergenic
1152654093 17:81512124-81512146 GCAGGGCGTCATGGTGGGCATGG - Exonic
1156473693 18:37392992-37393014 GTCAGGCCCCATGCTGGGCATGG - Intronic
1157608347 18:48940141-48940163 ATAATGGGCCATGGTGGGGAGGG - Intronic
1161509380 19:4662148-4662170 GTAAAGCGCCCCGCAGGGCACGG + Intronic
1163125836 19:15243726-15243748 GTGAAGGGCCATTGTGAGCATGG - Intronic
1163154172 19:15431147-15431169 GGAAAACGCAATGGTGGCCATGG - Intronic
1164291515 19:23873331-23873353 CTAAGGTGCCATGGTTGGCAAGG - Intergenic
1168532706 19:57142429-57142451 GTAAAGCTCAAGGCTGGGCATGG - Intronic
925555508 2:5127017-5127039 GTAAAGCGCATTTGTGGGCAGGG - Intergenic
934056274 2:88253856-88253878 GCAAAGAGTCAGGGTGGGCAAGG - Intergenic
935094629 2:99932607-99932629 GTAAGGGGCCATAGTGTGCAAGG - Intronic
941405155 2:165078344-165078366 GGAAAGCACCATGGTGGGTCCGG + Intergenic
942606109 2:177692965-177692987 GGAAAGGGCCAGGCTGGGCAGGG - Intronic
943944152 2:194037031-194037053 AAAAAGCGCCAGGCTGGGCATGG + Intergenic
944131046 2:196347764-196347786 GACAAGCACCATGGTTGGCAAGG - Intronic
945663924 2:212718946-212718968 GTTAAGGGCCATGGTGAGAAAGG + Intergenic
945683265 2:212938579-212938601 GTAAGGTGCCAAGGTGTGCAGGG + Intergenic
945683387 2:212939571-212939593 GTAAGGTGCCAGGGTGTGCAGGG - Intergenic
946245332 2:218384114-218384136 GGAATGGGCCATGGAGGGCAGGG + Intronic
946388703 2:219402230-219402252 GTAAAGGGCAATGGTGGGGAAGG + Intergenic
946836207 2:223775057-223775079 AGAAAGCGTCATGGTGAGCAAGG + Intronic
1172537015 20:35681840-35681862 ACAGAGCCCCATGGTGGGCAGGG + Intronic
1172591264 20:36119690-36119712 GGAAAGGGACAAGGTGGGCAGGG + Intronic
1172791169 20:37506479-37506501 GCAAAGGGCGAGGGTGGGCAAGG - Intronic
1176110618 20:63408976-63408998 GTAAAGCTCCGGGGTGGGCACGG - Intronic
1180160261 21:45995994-45996016 GGAGAGCCCCATGCTGGGCAGGG - Intronic
1180789767 22:18569171-18569193 GTAAAGCCTCATGCCGGGCATGG + Intergenic
1181231975 22:21426135-21426157 GTAAAGCCTCATGCCGGGCATGG - Intronic
1181246676 22:21508726-21508748 GTAAAGCCTCATGCCGGGCATGG + Intergenic
1182620764 22:31617249-31617271 GTAGAGAGCCATGGTGGAGATGG - Intronic
1185345287 22:50308046-50308068 GGACGGCGGCATGGTGGGCAGGG - Intergenic
954725319 3:52603918-52603940 GTAAAGGAAAATGGTGGGCATGG - Intronic
956158743 3:66325710-66325732 GTAAAGCACCAAGGAGGGCCCGG + Intronic
960970809 3:123138874-123138896 GTAAAGCTCCCTGGTAGCCAGGG - Intronic
961798998 3:129430039-129430061 GTAAAGCCCTGTGGTGGGGAGGG - Intergenic
963908295 3:150792330-150792352 GGAAAGCAGCGTGGTGGGCAGGG + Intergenic
966932581 3:184685435-184685457 CTAAAATGCCAGGGTGGGCAAGG - Intergenic
976319940 4:83702476-83702498 GTAAAGCTCCTTGGTAGTCAAGG - Intergenic
983110729 4:163746186-163746208 GAAAAGAGCCATGGTGTCCAGGG - Intronic
986314856 5:6579835-6579857 GCAGAGCTCCATGGTGAGCATGG + Intergenic
997405126 5:133639648-133639670 TGGAAGCCCCATGGTGGGCAGGG + Intergenic
1002012139 5:176291766-176291788 GTAAAGTGCCCTGCTGGGCGCGG - Intronic
1004535226 6:16494018-16494040 CTTAAGCTCCTTGGTGGGCAGGG - Intronic
1011855312 6:91682538-91682560 GTAAAGCACCATGGCTGCCAAGG - Intergenic
1012916954 6:105180322-105180344 GTAAATCACCATAGTGGGGACGG + Intergenic
1017138179 6:151166621-151166643 GTAAAGCGTCATGTTAGGCCAGG + Intergenic
1017740563 6:157403023-157403045 GTATATCGCCAGGCTGGGCATGG - Intronic
1029208485 7:98884799-98884821 GCAGAGGGCCATGGTGGTCATGG + Intronic
1031547906 7:123072223-123072245 GCAAAGAGCTATGCTGGGCATGG + Intergenic
1031665472 7:124477987-124478009 GTGTTGGGCCATGGTGGGCATGG - Intergenic
1035714137 8:1740928-1740950 GGGAAGCCCCATGGTGGGCTGGG - Intergenic
1039357892 8:36841399-36841421 GTAAAGAACAATGCTGGGCATGG + Intronic
1040380220 8:46865136-46865158 CTAGAGCTGCATGGTGGGCACGG - Intergenic
1040471325 8:47737890-47737912 GCACAGCTCCAGGGTGGGCACGG + Exonic
1040902782 8:52433946-52433968 GTAAAGCGCCATGGTGGGCAGGG - Intronic
1049662300 8:143824885-143824907 TTTAAGCAGCATGGTGGGCAGGG + Intronic
1049710285 8:144060279-144060301 GAGAAGCGCGATGCTGGGCATGG - Intronic
1055009838 9:71553165-71553187 GCAAAGCTCCATGCTGTGCAGGG - Intergenic
1059915873 9:119099438-119099460 GTAAAGAGCCATGATGGGAGTGG + Intergenic
1060268196 9:122124481-122124503 GGAATTGGCCATGGTGGGCATGG - Intergenic
1061194034 9:129097898-129097920 TTCCAGCCCCATGGTGGGCACGG - Intronic
1186761686 X:12729755-12729777 GGGAAGAGCCTTGGTGGGCATGG - Intergenic
1187600558 X:20824565-20824587 GAAAAATGCCAGGGTGGGCATGG + Intergenic
1187800189 X:23053471-23053493 TAAAAGCTCCAAGGTGGGCAGGG + Intergenic
1189186572 X:39060302-39060324 GTGCAGAGCCATGTTGGGCATGG - Intergenic
1190468125 X:50747777-50747799 GTAGAGGGCAGTGGTGGGCAGGG + Intronic
1198129121 X:133676349-133676371 GTGCATGGCCATGGTGGGCATGG + Intronic
1198692653 X:139301097-139301119 GCACAGTGCCATGGGGGGCAAGG - Intergenic
1200255569 X:154580719-154580741 CTAAAACGCCATGGAGGCCATGG - Intergenic
1200262200 X:154623685-154623707 CTAAAACGCCATGGAGGCCATGG + Intergenic