ID: 1040905153

View in Genome Browser
Species Human (GRCh38)
Location 8:52461422-52461444
Sequence ACTCCGGCAGCCCCTGCAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040905153_1040905162 30 Left 1040905153 8:52461422-52461444 CCTTCTGCAGGGGCTGCCGGAGT No data
Right 1040905162 8:52461475-52461497 GTACAAAGCACTATTTGGTGTGG No data
1040905153_1040905156 0 Left 1040905153 8:52461422-52461444 CCTTCTGCAGGGGCTGCCGGAGT No data
Right 1040905156 8:52461445-52461467 CCATCAGAGAAAACATACCACGG No data
1040905153_1040905157 1 Left 1040905153 8:52461422-52461444 CCTTCTGCAGGGGCTGCCGGAGT No data
Right 1040905157 8:52461446-52461468 CATCAGAGAAAACATACCACGGG No data
1040905153_1040905161 25 Left 1040905153 8:52461422-52461444 CCTTCTGCAGGGGCTGCCGGAGT No data
Right 1040905161 8:52461470-52461492 GTCTTGTACAAAGCACTATTTGG No data
1040905153_1040905158 2 Left 1040905153 8:52461422-52461444 CCTTCTGCAGGGGCTGCCGGAGT No data
Right 1040905158 8:52461447-52461469 ATCAGAGAAAACATACCACGGGG No data
1040905153_1040905159 3 Left 1040905153 8:52461422-52461444 CCTTCTGCAGGGGCTGCCGGAGT No data
Right 1040905159 8:52461448-52461470 TCAGAGAAAACATACCACGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040905153 Original CRISPR ACTCCGGCAGCCCCTGCAGA AGG (reversed) Intergenic
No off target data available for this crispr