ID: 1040907198

View in Genome Browser
Species Human (GRCh38)
Location 8:52480865-52480887
Sequence GAAGCTCCAGTTCAGCAGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040907198_1040907200 2 Left 1040907198 8:52480865-52480887 CCTCACTGCTGAACTGGAGCTTC No data
Right 1040907200 8:52480890-52480912 AAAACTTCCTCCAGTCCCCCAGG No data
1040907198_1040907203 11 Left 1040907198 8:52480865-52480887 CCTCACTGCTGAACTGGAGCTTC No data
Right 1040907203 8:52480899-52480921 TCCAGTCCCCCAGGAGAGGAAGG No data
1040907198_1040907201 7 Left 1040907198 8:52480865-52480887 CCTCACTGCTGAACTGGAGCTTC No data
Right 1040907201 8:52480895-52480917 TTCCTCCAGTCCCCCAGGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040907198 Original CRISPR GAAGCTCCAGTTCAGCAGTG AGG (reversed) Intergenic
No off target data available for this crispr