ID: 1040911944

View in Genome Browser
Species Human (GRCh38)
Location 8:52528392-52528414
Sequence GAGATGTTATCTGCAGAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040911944_1040911948 21 Left 1040911944 8:52528392-52528414 CCATCTTCTGCAGATAACATCTC No data
Right 1040911948 8:52528436-52528458 GGCGAGTTACTGGACCTTGGTGG No data
1040911944_1040911946 11 Left 1040911944 8:52528392-52528414 CCATCTTCTGCAGATAACATCTC No data
Right 1040911946 8:52528426-52528448 GACAGCTCTTGGCGAGTTACTGG No data
1040911944_1040911947 18 Left 1040911944 8:52528392-52528414 CCATCTTCTGCAGATAACATCTC No data
Right 1040911947 8:52528433-52528455 CTTGGCGAGTTACTGGACCTTGG No data
1040911944_1040911945 0 Left 1040911944 8:52528392-52528414 CCATCTTCTGCAGATAACATCTC No data
Right 1040911945 8:52528415-52528437 TGCTTTTGAGAGACAGCTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040911944 Original CRISPR GAGATGTTATCTGCAGAAGA TGG (reversed) Intergenic
No off target data available for this crispr