ID: 1040911948

View in Genome Browser
Species Human (GRCh38)
Location 8:52528436-52528458
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040911944_1040911948 21 Left 1040911944 8:52528392-52528414 CCATCTTCTGCAGATAACATCTC No data
Right 1040911948 8:52528436-52528458 GGCGAGTTACTGGACCTTGGTGG No data
1040911943_1040911948 25 Left 1040911943 8:52528388-52528410 CCTGCCATCTTCTGCAGATAACA No data
Right 1040911948 8:52528436-52528458 GGCGAGTTACTGGACCTTGGTGG No data
1040911942_1040911948 26 Left 1040911942 8:52528387-52528409 CCCTGCCATCTTCTGCAGATAAC 0: 180
1: 172
2: 120
3: 86
4: 284
Right 1040911948 8:52528436-52528458 GGCGAGTTACTGGACCTTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040911948 Original CRISPR GGCGAGTTACTGGACCTTGG TGG Intergenic
No off target data available for this crispr