ID: 1040915284

View in Genome Browser
Species Human (GRCh38)
Location 8:52562608-52562630
Sequence AGATGTGAGCTGGAGGTGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 831
Summary {0: 1, 1: 0, 2: 2, 3: 89, 4: 739}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040915284_1040915294 12 Left 1040915284 8:52562608-52562630 CCCCCCACCTCCAGCTCACATCT 0: 1
1: 0
2: 2
3: 89
4: 739
Right 1040915294 8:52562643-52562665 GTTGCCTGGCCTACAGAAAAAGG No data
1040915284_1040915293 -2 Left 1040915284 8:52562608-52562630 CCCCCCACCTCCAGCTCACATCT 0: 1
1: 0
2: 2
3: 89
4: 739
Right 1040915293 8:52562629-52562651 CTGCATTTAGGGAAGTTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040915284 Original CRISPR AGATGTGAGCTGGAGGTGGG GGG (reversed) Intronic
900291176 1:1924225-1924247 GGTGGTGAGCTGGAGGGGGGTGG - Intronic
901004243 1:6164152-6164174 GGAAGGGAGATGGAGGTGGGAGG - Intronic
901144625 1:7056712-7056734 AGAGATGAGTTGGTGGTGGGGGG + Intronic
901492918 1:9605761-9605783 TGGTGTGAGCAGGAGCTGGGAGG + Intronic
901640114 1:10688848-10688870 AGCTGGGAGCAGGAGGAGGGCGG - Intronic
901921347 1:12539992-12540014 CCGTGTGAGCAGGAGGTGGGTGG + Intergenic
902197100 1:14805825-14805847 AGGTGGGAGCTGGATCTGGGGGG + Intronic
902308028 1:15558288-15558310 ACCTGGGAGGTGGAGGTGGGAGG - Intronic
902506316 1:16940833-16940855 AGTTGGGAGGTAGAGGTGGGAGG - Intronic
902535121 1:17115287-17115309 GTCTGTGAGGTGGAGGTGGGAGG - Intronic
902649525 1:17827501-17827523 TCATGTGATCTGGAGGTGGAGGG + Intergenic
902784821 1:18726222-18726244 AGAGGTGAGGTGGGGGTGGAGGG - Intronic
902887641 1:19417750-19417772 AAATGTGAGCTGGGGGCGGTCGG - Intronic
902919906 1:19659451-19659473 ACATGGGAGGTTGAGGTGGGAGG + Intergenic
903350785 1:22715407-22715429 AGAGTTGAGCTGGGGGAGGGAGG - Intronic
903936491 1:26898773-26898795 ACTTGTGAGGTTGAGGTGGGGGG - Intronic
904557115 1:31372669-31372691 ATATGTGATTTGGAGGTAGGAGG - Intronic
904840734 1:33370334-33370356 AGCTGGGAGCTGGAGAAGGGTGG - Intronic
905093805 1:35451415-35451437 AGATGTAAGCAGGAGGAGGGAGG + Intronic
905201711 1:36320860-36320882 AGGTGAGGGCTGGAGGTGAGGGG - Intronic
905441720 1:38000326-38000348 AGATGTTAGCAGGAGGTGGCAGG - Intronic
905546934 1:38807540-38807562 TGGTGGGAGCTGGAGATGGGAGG - Intergenic
905655738 1:39684865-39684887 AGGTGTGAGCAGGAGGGGAGAGG - Intronic
905785894 1:40757320-40757342 AGCTGTGAGCTCAAGGTGGCTGG + Intronic
905792528 1:40797856-40797878 AGCTGGGAGCTGGTGGTGTGTGG + Intronic
905904051 1:41604994-41605016 ACTTGGGAGGTGGAGGTGGGAGG + Intronic
906137771 1:43511798-43511820 AGATGAGAGATGGAGGGGGATGG + Intergenic
906204230 1:43978820-43978842 AGGCGTGGGCTGGAGGTGGCTGG - Intergenic
906231524 1:44169084-44169106 ACATGTAATCTGGTGGTGGGCGG + Intergenic
906290987 1:44619062-44619084 AGATGGGGGCTGGAGGTTGAAGG + Intronic
906615389 1:47229879-47229901 CGCTTTGGGCTGGAGGTGGGTGG - Intronic
906626657 1:47331448-47331470 AGATGGGAGGCTGAGGTGGGAGG - Intergenic
907548241 1:55281819-55281841 ACATGGGAGGTTGAGGTGGGAGG - Intergenic
907589595 1:55653633-55653655 ACATGTGAGGCTGAGGTGGGAGG - Intergenic
907896385 1:58696690-58696712 ATATGTCAGATGGAGATGGGTGG - Intronic
907925986 1:58955566-58955588 ACATGTGAACTGGTGGGGGGGGG + Intergenic
909532291 1:76694446-76694468 AGATGTGACCTAGAAGTTGGAGG + Intergenic
910042772 1:82873547-82873569 AAATGCGAGCTGGAGAAGGGTGG + Intergenic
910775951 1:90875026-90875048 GGAAGTGAGGTGGAGATGGGAGG - Intergenic
911741993 1:101396071-101396093 ACTTGTGAGGGGGAGGTGGGAGG + Intergenic
911995259 1:104758157-104758179 GGATGGGGGATGGAGGTGGGGGG + Intergenic
912181255 1:107221634-107221656 ACATGAGAGCTGGAGGTGGAAGG + Intronic
912194401 1:107380346-107380368 AGATGGGAGAAGGAGGTGTGTGG + Intronic
912342915 1:108935410-108935432 AGATGAGTGCTGAATGTGGGTGG + Intronic
912346065 1:108964283-108964305 AGATGAGTGCTGGAGATGGATGG - Intergenic
912587260 1:110778365-110778387 AGAGGTAGGCAGGAGGTGGGGGG + Intergenic
912694756 1:111832892-111832914 GGTGGTGAGCTGGAGGAGGGAGG - Intronic
912734813 1:112141353-112141375 AGATTGGAGCTGTGGGTGGGTGG + Intergenic
912769634 1:112451866-112451888 AGATGGAACCTGGAGGTGGCAGG - Intronic
912867354 1:113269731-113269753 AGAGGTGAGATGGCGGTGGGAGG - Intergenic
913250382 1:116908508-116908530 ACTTGAGAGGTGGAGGTGGGAGG + Intergenic
913301436 1:117374050-117374072 ATGTGGGAGGTGGAGGTGGGAGG + Intronic
914443255 1:147725579-147725601 TGATGCGAGCTGGAGGTTGGAGG + Intergenic
915311993 1:155009597-155009619 GGATGTGGGGTGGGGGTGGGGGG - Intronic
915476326 1:156154752-156154774 AATAGAGAGCTGGAGGTGGGTGG + Intronic
915554366 1:156653152-156653174 AGATGTGAGCCACAGGTGGAGGG - Intronic
915784732 1:158597312-158597334 AGATGTGCTCTTGAGGTGGGGGG - Intergenic
915799056 1:158769270-158769292 ACTTGTGGGGTGGAGGTGGGAGG - Intergenic
915918476 1:159956359-159956381 ATATGTGAGGCTGAGGTGGGAGG + Intergenic
916194367 1:162209757-162209779 AGCTGAGAGCTGGGGGCGGGGGG + Intronic
916760010 1:167807173-167807195 ACTTGGGAGGTGGAGGTGGGAGG - Intergenic
916882354 1:169032209-169032231 ACTTGGGAGCTTGAGGTGGGAGG - Intergenic
917800995 1:178570607-178570629 CTTTGGGAGCTGGAGGTGGGAGG - Intergenic
918053945 1:181002243-181002265 AGATGGGAGGCTGAGGTGGGAGG - Intronic
918248553 1:182681718-182681740 ATGTCTGAGCTGGAGGCGGGAGG + Intronic
918461643 1:184783042-184783064 ACTTGGGAGCTTGAGGTGGGAGG - Intergenic
919690237 1:200522542-200522564 AGATTAGTGGTGGAGGTGGGAGG + Intergenic
919918742 1:202155406-202155428 AGCAGTGAGCTGGAGCAGGGAGG + Intronic
920307969 1:205031104-205031126 AGATGCGCCCTGGAGGAGGGCGG - Intergenic
921039011 1:211411853-211411875 ATATGGGAGGTTGAGGTGGGAGG - Intergenic
921172327 1:212560601-212560623 AGAAGTGAGCTGGAGGCGGAAGG - Intergenic
921266151 1:213422177-213422199 AGATGAGGGCTGGAGGAAGGAGG - Intergenic
921376866 1:214483478-214483500 AGTTGTTAACTGGAGGCGGGTGG - Intronic
921551802 1:216546094-216546116 TGATGAGAGCAGGAGGTGGGGGG + Intronic
921832562 1:219744516-219744538 ACTTGGGAGGTGGAGGTGGGAGG - Intronic
921840559 1:219823663-219823685 AGAAGAGAGAGGGAGGTGGGTGG - Intronic
921921076 1:220670186-220670208 ACTTGGGAGATGGAGGTGGGAGG + Intergenic
922123371 1:222697825-222697847 AGCTGGGAGCTGGAGGTGGTGGG + Intronic
922304958 1:224336329-224336351 ATTTGGGAGGTGGAGGTGGGTGG - Intergenic
922591889 1:226783674-226783696 ACTTGGGAGGTGGAGGTGGGAGG - Intergenic
922739672 1:228008039-228008061 ATATGTGCAGTGGAGGTGGGAGG - Intronic
923190027 1:231611323-231611345 AGCTGTCAGCTGCAGGTTGGGGG + Intronic
923420977 1:233814632-233814654 AGAGGGAAGCTGGAGGTGGCTGG + Intergenic
923533104 1:234827315-234827337 AGACTTGAGCAGAAGGTGGGCGG - Intergenic
924207218 1:241725643-241725665 AGTTGTGAACTGGAGGAGGCAGG - Intronic
924319286 1:242831186-242831208 AGTTGTGCGCTGGCGGTTGGGGG + Intergenic
924432647 1:244009890-244009912 AGGTGCTAGCTGGAGGTGAGGGG + Intergenic
1063028302 10:2205212-2205234 AGATAAGAGTTGGAGGTGTGTGG + Intergenic
1063186929 10:3660194-3660216 TGATATAAGATGGAGGTGGGAGG + Intergenic
1064104893 10:12492548-12492570 ACTTGGGAGGTGGAGGTGGGAGG + Intronic
1064301906 10:14130367-14130389 ACTTGGGAGGTGGAGGTGGGAGG - Intronic
1064947262 10:20804907-20804929 AGATCAGAGCAGGAGGTGGGTGG + Intronic
1065195016 10:23256108-23256130 ACTTGGGAGGTGGAGGTGGGAGG - Intergenic
1065379988 10:25080380-25080402 ATTTGTGAGCCCGAGGTGGGTGG - Intergenic
1065546874 10:26830509-26830531 ACTTGGGAGCTTGAGGTGGGAGG + Intronic
1065931213 10:30480563-30480585 AGATATGAGCTGTACGTGGACGG + Intergenic
1065963556 10:30753235-30753257 TGCAGTGAGCGGGAGGTGGGAGG - Intergenic
1066108410 10:32175759-32175781 AGAGGTTAGCAAGAGGTGGGTGG + Intergenic
1066316156 10:34248646-34248668 AGGTGTGTGCTGGTGCTGGGAGG - Intronic
1066489056 10:35876378-35876400 AGATGTGAGCGGGACCTTGGCGG + Intergenic
1066672658 10:37857166-37857188 AGAGGTGAGCTGGAGCTGAGGGG - Exonic
1067935415 10:50607944-50607966 TGATCTGAGTTGGAGGAGGGAGG - Intronic
1068648667 10:59497698-59497720 ATATGCTACCTGGAGGTGGGAGG - Intergenic
1069598249 10:69686648-69686670 AAATGTTAGCTGGAGGGGGATGG + Intronic
1069938520 10:71936915-71936937 ACATATGAATTGGAGGTGGGGGG + Intergenic
1070582171 10:77730332-77730354 ACATGTGACTTGGAGGGGGGCGG + Intergenic
1070602255 10:77873976-77873998 CAGTGTGAGCTGGAGGAGGGCGG - Intronic
1070672292 10:78386492-78386514 AGATGAGAGATGGAGGGAGGAGG + Intergenic
1070811512 10:79300477-79300499 AGATGGGAGCTAGAGCTGTGGGG + Intronic
1071438252 10:85666814-85666836 TGATGTGAGCTGTATGGGGGAGG - Intronic
1073332431 10:102679135-102679157 AGAACTGGGCTGGAGGTGGGAGG + Intronic
1073914466 10:108386212-108386234 AGAGGTGAGCAGCAGGTGAGTGG + Intergenic
1074188859 10:111118465-111118487 AGATGTAGGAAGGAGGTGGGAGG - Intergenic
1074233411 10:111560631-111560653 AGATGGCAGATTGAGGTGGGAGG - Intergenic
1074477539 10:113786195-113786217 AGAAATGGGATGGAGGTGGGGGG - Intergenic
1074784031 10:116823013-116823035 AGAGGTGAGTTGGGGTTGGGTGG - Intergenic
1074817248 10:117151726-117151748 AAAAGTCAGCTGGAGGTGAGGGG + Intergenic
1075088936 10:119432061-119432083 AGCTGTTAGATGGAGGAGGGTGG - Intronic
1075095522 10:119468514-119468536 ACTTGGGAGCTGGGGGTGGGGGG - Intergenic
1075156633 10:119982615-119982637 ACGTGTGAAATGGAGGTGGGGGG + Intergenic
1075672270 10:124270715-124270737 AGATGTGACCTTGTTGTGGGCGG - Intergenic
1075760532 10:124852325-124852347 ACTTGGGAGGTGGAGGTGGGAGG + Intergenic
1076121469 10:127940108-127940130 AGATGTGAGCAGGTGGAGGCAGG + Intronic
1076250777 10:128982392-128982414 TCCTGTGACCTGGAGGTGGGGGG + Intergenic
1076556095 10:131322340-131322362 AAATGTGAGCTGCATGTGGCAGG + Intergenic
1076689448 10:132214255-132214277 TGAAATGAGCTGGGGGTGGGGGG + Intronic
1076739511 10:132476435-132476457 AGATGGGGTTTGGAGGTGGGAGG - Intergenic
1076739528 10:132476495-132476517 AGATGGGGTTTGGAGGTGGGAGG - Intergenic
1076765045 10:132628447-132628469 AGATGTGCTCTGGTGGCGGGGGG + Intronic
1076882655 10:133247225-133247247 AGAGGAGGGCTGGAGCTGGGCGG - Intergenic
1076989835 11:267294-267316 AGAAGTGAGGAGGAGGGGGGAGG + Intergenic
1077242742 11:1519285-1519307 GGATGTGTGCTGGGGGTGTGTGG - Intergenic
1077424269 11:2467075-2467097 GGAGGTGACCTGGAGGTCGGAGG + Intronic
1077452292 11:2655679-2655701 GGAGGGGAGCTGGGGGTGGGTGG - Intronic
1077629906 11:3804347-3804369 ATGAGTGAGCTGGGGGTGGGTGG + Intronic
1078259440 11:9691011-9691033 AGATGGGAGGCTGAGGTGGGAGG - Intronic
1079210478 11:18456285-18456307 AGCTGAGAACTGGAGGTTGGGGG + Exonic
1080471316 11:32548447-32548469 ACTTGGGAGATGGAGGTGGGAGG - Intergenic
1080634552 11:34112209-34112231 ATGTGTGTGCTGCAGGTGGGTGG + Exonic
1081655645 11:44855751-44855773 AGATGTCAGGGGAAGGTGGGTGG - Intronic
1081756791 11:45550324-45550346 AGATGTGGGGTGGAGGTCAGTGG + Intergenic
1081779320 11:45699075-45699097 AGAAGTGAGCTGGAGAAGGTGGG - Intergenic
1082076006 11:47976629-47976651 AGGTGTGAGCTGGCACTGGGTGG + Intergenic
1083173302 11:60935221-60935243 GGAAAGGAGCTGGAGGTGGGGGG - Intronic
1083198332 11:61104404-61104426 AGAGGTGAGGAGCAGGTGGGGGG - Intronic
1083250635 11:61464332-61464354 ACATGGGAGGTGGAGGTGGGAGG - Intronic
1083338849 11:61945716-61945738 AGTTCTGAGCTGGAGGGGTGGGG + Intergenic
1083428099 11:62599659-62599681 AGATGTAAAATGGAGGGGGGCGG + Intronic
1083570941 11:63762187-63762209 AGCTGTGAGGTGGTGGAGGGAGG - Exonic
1083725834 11:64627532-64627554 AGATGGGGGCTGGAACTGGGGGG - Intronic
1083728770 11:64642372-64642394 TGATGGGAGCTGGAGATTGGAGG + Intronic
1083843868 11:65319877-65319899 TGATGTGCAATGGAGGTGGGGGG + Intronic
1083907050 11:65679667-65679689 AGTTGGGGGGTGGAGGTGGGAGG + Intergenic
1084040936 11:66542407-66542429 AGCTCTGAGCTGGACGTCGGTGG + Intronic
1084370818 11:68741543-68741565 AAATGTAAGCTGCAGGAGGGCGG + Intronic
1084442449 11:69182473-69182495 AGGTGTGACTTGGAGGTGGCTGG + Intergenic
1084542225 11:69794139-69794161 AGATGGGAGGTGGAGGCAGGAGG + Intergenic
1085254896 11:75166900-75166922 AGGTGTGAGCTGGTGGGAGGAGG - Intronic
1085406697 11:76267410-76267432 AGAGGAGACCTGGGGGTGGGGGG - Intergenic
1085499510 11:77006864-77006886 ACATGGGAGGTTGAGGTGGGAGG + Intronic
1085673948 11:78497497-78497519 AGAAGTGATATGGAGGTTGGGGG - Intronic
1085757406 11:79213131-79213153 AAAAGTGAGCTAGTGGTGGGAGG + Intronic
1085952250 11:81346039-81346061 AGAAGGGAGGTGGAGGTGTGGGG + Intergenic
1086388396 11:86334755-86334777 ACTTGGGAGGTGGAGGTGGGAGG - Intronic
1086935468 11:92741282-92741304 ATTTGTGAGGTGGTGGTGGGAGG - Intronic
1086949944 11:92881945-92881967 AGCTGGGGGCTGCAGGTGGGTGG - Intronic
1087292656 11:96337293-96337315 AGTTGAGAGCTGTAAGTGGGAGG - Intronic
1087508717 11:99061881-99061903 ACCTGGGAGGTGGAGGTGGGAGG + Intronic
1087745020 11:101933977-101933999 GGATGTGAGAGGGAGGTGGAAGG + Intronic
1088776505 11:113089537-113089559 ACTTGGGAGGTGGAGGTGGGTGG - Intronic
1088922344 11:114269723-114269745 TGGAGTGAGCTGGAGGTGAGAGG - Intronic
1089011684 11:115136810-115136832 AGATGTGATCTCGAGAAGGGTGG - Intergenic
1089671371 11:120059151-120059173 AGATGGGAGCCGGAGGTCAGTGG + Intergenic
1089697784 11:120226519-120226541 GGATGGGAGGTGGAGGTGGGTGG - Intronic
1089758879 11:120708378-120708400 GGAGCTGAGCTAGAGGTGGGAGG - Intronic
1090267846 11:125364878-125364900 AGATGGGAGCTTCAGCTGGGTGG - Intronic
1091033404 11:132211709-132211731 GGATATGTGTTGGAGGTGGGTGG + Intronic
1091175112 11:133550753-133550775 AGCTGTGAAATGGAGGTGTGGGG - Intergenic
1091208072 11:133834179-133834201 AGGTGAGAGCTGGGGGTGGCAGG - Intergenic
1091835689 12:3583979-3584001 AGGTGTGCCCTGGAGGTGGGAGG + Intronic
1091875760 12:3931693-3931715 AGGGGTGGGCTGGGGGTGGGGGG - Intergenic
1091932675 12:4409218-4409240 AGATGGGAGCCTGAGGTGGGAGG + Intergenic
1092259880 12:6947092-6947114 AGAAGTTGGCTGGACGTGGGAGG - Intronic
1092282874 12:7110519-7110541 GGAGATGAGCTGGAGGAGGGAGG + Intergenic
1092410342 12:8248084-8248106 AGATGGCAGGTGGCGGTGGGGGG + Intergenic
1092561801 12:9622536-9622558 CTTTGTGAGGTGGAGGTGGGTGG - Intergenic
1092788574 12:12051984-12052006 AGATGTGAGAAGGACGTGGGTGG + Intronic
1092943666 12:13433650-13433672 AGTAGTGGGCTGGAGGTGGATGG + Intergenic
1093058536 12:14579171-14579193 AAATGGTGGCTGGAGGTGGGGGG + Intergenic
1093706636 12:22281897-22281919 ACTTGGGAGGTGGAGGTGGGAGG + Intronic
1094118742 12:26946417-26946439 AGCTGGGAGGTGGAGGTAGGAGG - Intronic
1094149866 12:27270755-27270777 ATTTGGGAGGTGGAGGTGGGAGG - Intronic
1095622397 12:44273216-44273238 TGTTGTGGGGTGGAGGTGGGGGG + Intronic
1095745183 12:45650233-45650255 AGGTGTGAGTTGGAGGTGATGGG - Intergenic
1095954428 12:47798236-47798258 AGGAGGGGGCTGGAGGTGGGTGG + Intronic
1097778821 12:63680121-63680143 ATATGTGTGCTGGGGGTGGGGGG - Intergenic
1098160893 12:67648112-67648134 GGGTGTGTGGTGGAGGTGGGAGG + Intergenic
1098640609 12:72834699-72834721 GGATGTGAACTGGAGATGTGAGG + Intergenic
1099284829 12:80704687-80704709 AGTTGAGGGCAGGAGGTGGGAGG - Intergenic
1099411824 12:82339360-82339382 CTTTGGGAGCTGGAGGTGGGAGG - Intronic
1100569892 12:95837552-95837574 AGATGTGAGAGGGAGGAGAGAGG + Intergenic
1100573103 12:95861106-95861128 AGAAGAGAGTTGGTGGTGGGAGG + Intronic
1100964529 12:99998396-99998418 ACTTGGGAGATGGAGGTGGGAGG + Intergenic
1101118021 12:101551117-101551139 ACCTGGGAGGTGGAGGTGGGAGG - Intergenic
1101141425 12:101799853-101799875 AGATTTGGGGTGGGGGTGGGAGG + Intronic
1101413346 12:104487368-104487390 AGTTGTGAGGCTGAGGTGGGAGG - Intronic
1102480554 12:113220679-113220701 ACATGGGAGCTGTGGGTGGGAGG - Intronic
1102566172 12:113798826-113798848 AGATGTGAGCTTCAGGGGGGCGG + Intergenic
1102636922 12:114332658-114332680 AGCTGGAAGTTGGAGGTGGGGGG + Intergenic
1103727702 12:123006602-123006624 ACTTGTGAGGTGGAGGTGGGGGG + Intronic
1103729029 12:123013780-123013802 AGATGGCATGTGGAGGTGGGAGG + Intronic
1103889186 12:124225624-124225646 AGACTGGAGCTGGGGGTGGGAGG + Intronic
1103948803 12:124540889-124540911 AGTGGAGAGCTGGAGGGGGGTGG + Intronic
1104363887 12:128159228-128159250 AGATGTGAACTTGAAGAGGGTGG + Intergenic
1104632859 12:130418976-130418998 AGGTGTGGGGTAGAGGTGGGTGG + Intronic
1104757785 12:131279654-131279676 GGATGGGAGGTGGGGGTGGGTGG - Intergenic
1104790655 12:131480200-131480222 AGATGCTATCTGCAGGTGGGAGG + Intergenic
1104840237 12:131820723-131820745 ACTTGTGAGATGGTGGTGGGAGG + Intergenic
1105029667 12:132874011-132874033 AGAGGTGGGCTGGAGGGGAGGGG - Intronic
1106118306 13:26836468-26836490 ACATGTGAGCTGCAGGGGGTGGG + Intergenic
1106562840 13:30861837-30861859 ACTTGTGAGCTTGAGGTGGGAGG - Intergenic
1106620916 13:31369869-31369891 AGATGTGTGCTGGTGGTAGGTGG + Intergenic
1106752791 13:32792156-32792178 ACTTGGGAGATGGAGGTGGGAGG - Intergenic
1106820528 13:33459257-33459279 ACTTGGGTGCTGGAGGTGGGAGG - Intergenic
1107866853 13:44711398-44711420 AGTTGGGAGGTGGAGGTAGGAGG - Intergenic
1109180027 13:59202488-59202510 AGATGTGGGGTAGAGGTGGGAGG + Intergenic
1110209531 13:72955012-72955034 AGATAGGACCTGGAGTTGGGAGG + Intronic
1110861871 13:80353355-80353377 CGTTGGGAGGTGGAGGTGGGTGG + Intergenic
1111827985 13:93293089-93293111 ACTTGGGAGATGGAGGTGGGAGG - Intronic
1112031546 13:95460957-95460979 AAAAGTTAGCTGGATGTGGGTGG + Intronic
1112973809 13:105292217-105292239 AGATGAGATCTGGAGGTTTGGGG + Intergenic
1113962959 13:114135428-114135450 GGAGCTGAGCTGGAGGTGGGTGG - Intergenic
1114044434 14:18710291-18710313 AGATGTGGGCAGGAGTTTGGGGG + Intergenic
1114048719 14:18900742-18900764 AGATGTGGGCAGGAGTTTGGGGG + Intergenic
1114113795 14:19500904-19500926 AGATGTGGGCAGGAGTTTGGGGG - Intergenic
1114115495 14:19618655-19618677 AGATGTGGGCAGGAGTTTGGGGG - Intergenic
1115020986 14:28681712-28681734 AGATTGGAGATGGAGGTGGGGGG + Intergenic
1116015070 14:39396019-39396041 GGTTGGGAGCTGGAGGTGGGAGG + Intergenic
1116275251 14:42824467-42824489 AGAAGTTAGCTGCAGGGGGGAGG + Intergenic
1116598755 14:46890120-46890142 GGAAGTGAGCAGGAGGTGGCTGG - Intronic
1116667270 14:47793786-47793808 AGATGAGAGGCTGAGGTGGGCGG - Intergenic
1116696256 14:48182269-48182291 ACATGACAGCAGGAGGTGGGGGG - Intergenic
1116716356 14:48431387-48431409 AGAGGGGAGCTGGAAGGGGGCGG + Intergenic
1118470590 14:66071079-66071101 AAATTTGAGTAGGAGGTGGGAGG + Intergenic
1118715063 14:68553701-68553723 AGAGGTGGGGTGGAGGTGGGTGG + Intronic
1119084989 14:71731355-71731377 AGATTTTAGCTGCAGGTGGATGG - Intronic
1119287823 14:73470216-73470238 ATATGGGAGCCTGAGGTGGGTGG - Intergenic
1119324309 14:73750546-73750568 AGAGGTGAGCTGGAGGCTGCAGG + Intronic
1119425695 14:74533506-74533528 TGCAGTGAGCTGGAGGAGGGAGG + Intronic
1119494571 14:75067844-75067866 AGAAGTAAGCTGGGTGTGGGGGG + Intronic
1119538071 14:75419263-75419285 AGGGGTGAGCTGGAGGTGGGAGG - Intergenic
1119543723 14:75457069-75457091 AGATGCGGGCTGAGGGTGGGAGG - Intronic
1119665888 14:76484694-76484716 AGATGGGAGATGGAGCTGGGAGG - Intronic
1119771209 14:77221434-77221456 AGGTGTGAGTGGGAGGTGAGTGG - Intronic
1120151229 14:81036446-81036468 AGAGGTGAGGTGGGGGTGCGGGG + Intronic
1120663128 14:87274357-87274379 AGAGGTGAGATGGGAGTGGGTGG + Intergenic
1120792736 14:88600029-88600051 AGATTTGACCTGTAGGTGGGGGG - Intronic
1120817451 14:88877853-88877875 ACTTGGGAGGTGGAGGTGGGAGG + Exonic
1120843895 14:89109712-89109734 AGATGGGAATTGGAGTTGGGTGG + Intergenic
1121016441 14:90552164-90552186 AGAGGTGTGCAGGAGGTGTGGGG - Intronic
1121655798 14:95594687-95594709 AGATGCTAGGTGGAGATGGGAGG - Intergenic
1122154388 14:99741697-99741719 AGGTGAGAGCTGGGGGTGGCTGG - Intronic
1122386671 14:101353077-101353099 AGGTGGGAGCATGAGGTGGGAGG - Intergenic
1122930691 14:104931890-104931912 AGGTCTGAGTGGGAGGTGGGCGG + Intronic
1123504816 15:20930632-20930654 AGATGTGGGCAGGAGTTTGGGGG + Intergenic
1123562064 15:21504327-21504349 AGATGTGGGCAGGAGTTTGGGGG + Intergenic
1123598309 15:21941614-21941636 AGATGTGGGCAGGAGTTTGGGGG + Intergenic
1125514765 15:40312035-40312057 AGATGAGAGCTGTAGGTGGCAGG + Intergenic
1125953893 15:43776438-43776460 AAACGTGGGCTGGAGGTGGAAGG - Intronic
1126182117 15:45795540-45795562 AGATTTGGGTTGGAGGTTGGAGG - Intergenic
1126848949 15:52786084-52786106 ATATGGGAGCTGGTAGTGGGGGG + Intronic
1127288217 15:57548781-57548803 AGGTGTGAGAATGAGGTGGGAGG + Exonic
1128179344 15:65587871-65587893 ACATGAGAGGTTGAGGTGGGAGG + Intronic
1128300230 15:66562045-66562067 AGGTTTGGGCAGGAGGTGGGAGG - Intronic
1128300621 15:66564458-66564480 GGATGTGAGGTGGATGTAGGAGG - Intronic
1128725692 15:69986959-69986981 AGAGGTGGCATGGAGGTGGGAGG + Intergenic
1129077663 15:73011059-73011081 AGAAGTGTGCTGGAGGTGTGTGG + Intergenic
1129221870 15:74135904-74135926 AGAAGTGGGGTGGGGGTGGGAGG - Exonic
1129666043 15:77579919-77579941 CAGTGTGAGCTGGGGGTGGGGGG - Intergenic
1129948614 15:79563993-79564015 AGCTGGGACCTGGAGGTGGTGGG + Intergenic
1130233412 15:82113664-82113686 AGATGTCAGCTGGGGGTGGTAGG - Intergenic
1130333125 15:82936679-82936701 ACTTGTGAGGTTGAGGTGGGAGG - Intronic
1131059438 15:89395578-89395600 TGCTGTGAGCAGGAGGAGGGAGG - Intergenic
1131399939 15:92116483-92116505 ACTTGGGAGCTGGAGGTGGGAGG - Intronic
1131472429 15:92708762-92708784 AGAGGTGAGTGGGAGCTGGGTGG - Intronic
1131616004 15:94018032-94018054 AGATTGGAGCTGGAGGAGAGAGG + Intergenic
1131671109 15:94620306-94620328 GGAAGTGGGGTGGAGGTGGGGGG + Intergenic
1131755599 15:95557501-95557523 AGATGTAATCTGGATGTAGGGGG + Intergenic
1132234665 15:100210259-100210281 AGAAGTGAGCTGGAACAGGGAGG + Intronic
1132352148 15:101146533-101146555 AGAAGGGAGCTGGAGGAGTGAGG + Intergenic
1202970409 15_KI270727v1_random:231466-231488 AGATGTGGGCAGGAGTTTGGGGG + Intergenic
1132460798 16:53648-53670 CAATGTGAGCTCGAGGCGGGCGG - Intronic
1132654156 16:1034880-1034902 AGCTGTGAGCTCCGGGTGGGAGG + Intergenic
1132655703 16:1040943-1040965 AGGTGTGAGCTGGGGGTCTGGGG - Intergenic
1132666150 16:1082172-1082194 AGATGTGGGCTGTGGGTGGCCGG - Intergenic
1132713216 16:1278412-1278434 AGGTGTGCGGTGGGGGTGGGGGG - Intergenic
1132936343 16:2483197-2483219 AGCTGTGAGCTGGAGAGGAGAGG + Intronic
1133023577 16:2977715-2977737 AGAGGGGTGCTGGAGGTGGGAGG - Intronic
1133058556 16:3159721-3159743 ACTTGGGAGGTGGAGGTGGGAGG - Intergenic
1133351557 16:5104274-5104296 AGATGGCAGGTGGCGGTGGGGGG + Intergenic
1133581283 16:7146839-7146861 ACTTGGGAGGTGGAGGTGGGAGG + Intronic
1133830235 16:9316305-9316327 GGAGGTTATCTGGAGGTGGGTGG - Intergenic
1133864974 16:9633781-9633803 AGATGTGAGCAGCTGGAGGGTGG - Intergenic
1133887011 16:9839823-9839845 AGATGTGAACTGGGGATGGAGGG + Intronic
1134066127 16:11229599-11229621 ACTTGGGAGGTGGAGGTGGGAGG - Intergenic
1134117031 16:11556610-11556632 GCATGGGAGCTGGAGGTGTGGGG + Exonic
1134146625 16:11769896-11769918 ACTTGGGAGGTGGAGGTGGGAGG - Intronic
1134880429 16:17741200-17741222 GGATGTGGGGTGGAGGTTGGTGG - Intergenic
1135031324 16:19041138-19041160 ATTTGGGAGCTGGAGGTGGGAGG - Intronic
1135126621 16:19815560-19815582 AGATGGGAGGCTGAGGTGGGAGG + Intronic
1135328070 16:21540202-21540224 AGTTGGGAGGTTGAGGTGGGAGG + Intergenic
1135387185 16:22053204-22053226 CGTTGGGAGGTGGAGGTGGGTGG - Intronic
1135532647 16:23267687-23267709 AGATGTGACCTAGGGTTGGGAGG - Intergenic
1135538446 16:23312211-23312233 CTTTGTGAGCTCGAGGTGGGAGG - Intronic
1135760708 16:25135980-25136002 ACTTGGGAGGTGGAGGTGGGAGG + Intronic
1136382899 16:29904869-29904891 GGCTGTGAGCTGGTGGTCGGCGG + Exonic
1136495326 16:30639675-30639697 ACTTGGGAGGTGGAGGTGGGAGG + Intergenic
1137707220 16:50544002-50544024 AGATATGAGATGGAGGAGGCTGG - Intergenic
1137710725 16:50564885-50564907 AGCTGGGAGGTGGAGGTGGGCGG - Intronic
1137765121 16:50972097-50972119 AGATGGGAGCTGGAAGTTGCAGG + Intergenic
1137788286 16:51154295-51154317 AGATGGGAGGTGGAGGAGGGGGG + Intergenic
1137827407 16:51511161-51511183 AGAAGTTTGCTGGAGGTGAGAGG + Intergenic
1137876308 16:51999640-51999662 AGATGTGAATTGAAGGTGGAAGG - Intergenic
1138135864 16:54522112-54522134 AGGGCTGAGCTTGAGGTGGGAGG + Intergenic
1138202952 16:55103746-55103768 AGAAGTGGGTTGGAGGTGGATGG - Intergenic
1138354753 16:56368235-56368257 GGATGTGAGCTGGGGAAGGGAGG - Intronic
1139274742 16:65717001-65717023 TGCTGTGAGCTGGTGGTGGCGGG - Intergenic
1139762710 16:69199484-69199506 AGTTGGGAGGTTGAGGTGGGAGG + Intronic
1140340153 16:74150550-74150572 AGATGTGGGCAGGATGGGGGGGG - Intergenic
1140524308 16:75609810-75609832 ACTTGGGAGGTGGAGGTGGGAGG - Intronic
1140958199 16:79887296-79887318 AGATGTGTGTGAGAGGTGGGAGG - Intergenic
1141167281 16:81669078-81669100 AGGTGTGAGGTGGATGTGGAAGG - Intronic
1141167311 16:81669216-81669238 AGGTGTGAGGTGGATGTGGAAGG - Intronic
1141167321 16:81669264-81669286 AGGTGTGAGGTGGATGTGGAAGG - Intronic
1141167374 16:81669492-81669514 AGGTGTGAGGTGGATGTGGAAGG - Intronic
1141252569 16:82371558-82371580 TGGTGTGAGAAGGAGGTGGGTGG - Intergenic
1141496618 16:84414773-84414795 AGATGGGAGCTGCAGGAGGCTGG + Intronic
1141676218 16:85518860-85518882 AGGTGTGAGCCTGAGCTGGGTGG - Intergenic
1141809449 16:86365182-86365204 TGATGTCACCTGGGGGTGGGTGG - Intergenic
1142009772 16:87707950-87707972 AGGAGAGAGCTGAAGGTGGGTGG - Exonic
1142012477 16:87722893-87722915 AAATGTGAGGTGAGGGTGGGTGG + Intronic
1142222487 16:88862347-88862369 AGCTGTGGCGTGGAGGTGGGTGG + Exonic
1142616348 17:1138188-1138210 AGTTGAGAGCTGGACGTGGTGGG - Intronic
1142710235 17:1719015-1719037 AACTGGGAGCTGGGGGTGGGTGG - Intronic
1143176152 17:4956341-4956363 TGGTGTGGGCTGGGGGTGGGGGG - Intronic
1143490412 17:7282460-7282482 AAACCTGAGCTGGAGGAGGGGGG - Intronic
1144628366 17:16857058-16857080 AGCTGTGAGCAGGAGGCAGGAGG + Intergenic
1144727932 17:17511157-17511179 AGCTGGCAGCTGGAGGTGGGGGG - Intronic
1145015162 17:19391804-19391826 AGATGTCATCAGGAGGTGGGGGG - Intergenic
1145048043 17:19634687-19634709 ACATGGGAGGTTGAGGTGGGAGG - Intergenic
1145049169 17:19646386-19646408 ACTTGGGAGGTGGAGGTGGGAGG + Intergenic
1145060263 17:19728767-19728789 AGCTGTGAGCAGGAGGTGGAAGG - Intergenic
1145159958 17:20567628-20567650 AGCTGTGAGCAGGAGGCAGGAGG + Intergenic
1145909291 17:28533319-28533341 GGAACAGAGCTGGAGGTGGGCGG + Intronic
1145948922 17:28800382-28800404 AGATGTGAGGTGGAGGGAGTTGG + Intronic
1146439574 17:32882231-32882253 AGATGTCAGCTGAAGAGGGGAGG + Intergenic
1146511812 17:33456071-33456093 AAATGAGAGCTGGGGGTTGGGGG - Intronic
1146655712 17:34633603-34633625 AGCTAAGAGCAGGAGGTGGGCGG + Intronic
1146980748 17:37159067-37159089 ACTTGAGAGGTGGAGGTGGGAGG + Intronic
1147438562 17:40432694-40432716 AGATATGAGTAGGTGGTGGGTGG - Intergenic
1147927452 17:43954298-43954320 GGATGGGAGTTGGGGGTGGGAGG + Intronic
1147978730 17:44262104-44262126 AAATGAGGGCTGGGGGTGGGAGG - Intronic
1148192281 17:45687981-45688003 AGGGGTTAGCTTGAGGTGGGAGG + Intergenic
1148509840 17:48159035-48159057 GGAGGTGAGATGGAGGTGGCAGG - Intronic
1148697211 17:49567788-49567810 AGACGAGAGGTGGAGGTAGGGGG - Intergenic
1148905981 17:50912368-50912390 AGCCTTGAGCTGGAGGTGAGGGG - Intergenic
1148982793 17:51593455-51593477 AGATCTGAGCTGGAAATGGATGG - Intergenic
1149506089 17:57195150-57195172 ACATGGGAGGTGGAGGTGGGAGG - Intergenic
1150432446 17:65129230-65129252 AGCTGTGTGTTGGAGGTTGGGGG - Intergenic
1150722450 17:67625245-67625267 AGATGGGACCTGGGTGTGGGAGG - Intronic
1151171213 17:72247795-72247817 AGACATGAGGTGGAGGTGGTAGG + Intergenic
1151474437 17:74337832-74337854 AGAGCTGAGCTGGAGAGGGGTGG - Intronic
1151493797 17:74447521-74447543 AAATGTGAGCTGGATTTGGAGGG - Intronic
1151542430 17:74771414-74771436 AGGTGGGAGCTGGAGGTGCAGGG - Exonic
1151785494 17:76272985-76273007 AGATGGGAACTGGGGGTGGGGGG + Intergenic
1152263676 17:79281010-79281032 AGATGTGGTCTGGAGGTGATAGG - Intronic
1152715378 17:81897583-81897605 ACTTGAGAGGTGGAGGTGGGAGG - Intronic
1152856031 17:82664836-82664858 ACATGTGACCTGGAGGCCGGTGG + Intronic
1154074731 18:11188913-11188935 CGATGAGAGCAGAAGGTGGGAGG + Intergenic
1154086167 18:11307550-11307572 TGTTCTGAGCTGGGGGTGGGAGG - Intergenic
1154388040 18:13913245-13913267 AGATGTGAGCGGGTGGAAGGTGG - Intronic
1155248384 18:23932977-23932999 GGATTGGAGCAGGAGGTGGGAGG + Intronic
1156520998 18:37722187-37722209 AGATGGGAGGTGGGGGTGGGGGG + Intergenic
1156762940 18:40615303-40615325 AAATGTGAGGATGAGGTGGGAGG - Intergenic
1157033511 18:43942907-43942929 CTTTGTGAGCTTGAGGTGGGCGG + Intergenic
1157506551 18:48230662-48230684 GGATGTGAGCTGCCAGTGGGTGG + Intronic
1157529225 18:48408136-48408158 CGAGGGGAGCTGGGGGTGGGTGG - Intronic
1157589709 18:48829026-48829048 AGAGCTGAGCTGAAGGTGGGAGG + Intronic
1157590926 18:48836108-48836130 AGGTGGGGCCTGGAGGTGGGTGG - Intronic
1158257064 18:55563128-55563150 AGTTGGGAGGTTGAGGTGGGAGG + Intronic
1158547950 18:58411692-58411714 AAATGTAAGGTGGGGGTGGGGGG + Intergenic
1159131161 18:64281592-64281614 AGAGGTTTGCTGCAGGTGGGAGG + Intergenic
1159779603 18:72645836-72645858 AGATGTGAGCTGGAGAGGGGAGG - Intergenic
1159883954 18:73886533-73886555 ATTTGGGAGGTGGAGGTGGGTGG + Intergenic
1160939110 19:1611899-1611921 AGATGTGAGGTGGGAGTGGGGGG + Intronic
1160951052 19:1667606-1667628 AGATGGATGCTGGAGGTGTGGGG - Intergenic
1160971489 19:1769674-1769696 AGGTGTGAGTTGGAGTAGGGGGG - Intronic
1161093026 19:2372407-2372429 ACAGGTGACCTTGAGGTGGGAGG - Intergenic
1161414313 19:4136698-4136720 ATTTGGGAGGTGGAGGTGGGCGG - Intergenic
1162134707 19:8548208-8548230 GGATGTGGGCTGGAGGCAGGGGG + Intronic
1162429808 19:10621550-10621572 ACTTGGGAGGTGGAGGTGGGAGG - Intronic
1162738403 19:12759469-12759491 AGCTGGGAGGTGGAGATGGGTGG + Intergenic
1162784200 19:13023952-13023974 AGTTGTGAGTTGGGGGCGGGTGG - Intronic
1162819050 19:13211930-13211952 AGGTGTGACCAGGTGGTGGGTGG + Intronic
1162836047 19:13318628-13318650 GGATGGGGGCTGGAGTTGGGTGG + Intronic
1163376665 19:16937241-16937263 ACTTGGGAGGTGGAGGTGGGAGG - Intronic
1163652533 19:18526698-18526720 AGGTCTGAGCTGGTTGTGGGTGG - Intergenic
1163731781 19:18953846-18953868 AGATGTGAGTTGGAGGTCACTGG - Intergenic
1163790847 19:19305402-19305424 AGGTATGAGCTGCAGGTTGGAGG - Intronic
1163827212 19:19530373-19530395 AGCTGTGGGGTGGGGGTGGGAGG - Intronic
1164877252 19:31700199-31700221 AGATGTGTGCTGGAGGAAGATGG + Intergenic
1165185871 19:34020797-34020819 AGATCTGAGGCTGAGGTGGGAGG - Intergenic
1165758521 19:38307794-38307816 AGATGGGTGCTGGGGGTGGGGGG - Intronic
1165993214 19:39827473-39827495 AGGGGTGTGCTGGAGGTGGAGGG - Intronic
1166622547 19:44314810-44314832 AGATGTGAGGTGGAAGTCTGTGG - Intergenic
1166731568 19:45061979-45062001 AGATCTGAGGTGGGGGTGGGTGG + Intronic
1166785400 19:45364126-45364148 AGAGATGAGCTGGGGCTGGGAGG + Intronic
1166873334 19:45883645-45883667 AGAAGGGAGCGGGGGGTGGGGGG + Exonic
1167102925 19:47415106-47415128 AAACGTGGGCGGGAGGTGGGGGG + Intronic
1167177328 19:47874160-47874182 TGATGTGGGCTGTAGGTGGGTGG - Intronic
1167498524 19:49832627-49832649 AAATGTGAGCTGGATGTGACAGG + Intronic
1167595211 19:50423782-50423804 AGATGCCAGCTGGAGATGGTGGG + Intronic
1168234348 19:55052599-55052621 ACTTGGGAGGTGGAGGTGGGAGG - Intronic
1168433791 19:56302253-56302275 AAATGAGAGATGGAGGCGGGTGG - Intronic
1168593384 19:57654697-57654719 AAATGAGTGGTGGAGGTGGGGGG - Intergenic
1168688831 19:58364738-58364760 ATTTGGGAGGTGGAGGTGGGCGG + Intergenic
925836652 2:7952952-7952974 ACATGTGAGCTGAGGGTGTGTGG + Intergenic
926224366 2:10956512-10956534 AGAGCTGAGCTGGAGCTGTGTGG - Intergenic
926611571 2:14953141-14953163 AGCTGTGAGATGGAGCTGGAGGG + Intergenic
926682096 2:15671957-15671979 CGTTGGGAGGTGGAGGTGGGTGG - Intergenic
926910868 2:17851543-17851565 AGGTAGGAGTTGGAGGTGGGAGG - Intergenic
926953304 2:18267503-18267525 ACTTGGGAGCTTGAGGTGGGAGG - Intronic
927929706 2:27036387-27036409 AGATGTCAACTGGAAGAGGGAGG - Intronic
928603959 2:32927139-32927161 AGCTGTCAGGTGCAGGTGGGTGG - Intergenic
930317409 2:49814425-49814447 ATAGGTGGGGTGGAGGTGGGGGG - Intergenic
930585040 2:53258485-53258507 AGGTGTGACCTAGAAGTGGGAGG - Intergenic
931390041 2:61833784-61833806 ACTTGGGAGGTGGAGGTGGGAGG + Intronic
932259982 2:70318825-70318847 AGGGGTGAGCTGTGGGTGGGAGG + Intergenic
932574826 2:72956814-72956836 AACTGTGAGATGGAGGTTGGGGG - Intronic
932590512 2:73063909-73063931 AGATGGGAGCTGAATTTGGGAGG - Intronic
933203276 2:79476160-79476182 AGATGTGAAGTGGAGATGGCAGG + Intronic
933236208 2:79867407-79867429 AGATGAGAGATGGAGATGGATGG - Intronic
933648481 2:84830847-84830869 AGAGGGCAGCTGGAGATGGGCGG + Intronic
933727675 2:85435823-85435845 AGGTGGGAGCTGGAGGAGGCAGG + Exonic
934505632 2:94890513-94890535 AGAGGTGTGCTGGATGTGGAGGG - Intergenic
934611910 2:95745337-95745359 ACTTGGGAGGTGGAGGTGGGAGG + Intergenic
934759138 2:96843939-96843961 GGATGTGGGACGGAGGTGGGAGG - Intronic
934934493 2:98454751-98454773 GGATGTGGGCGGGGGGTGGGAGG + Intronic
935110973 2:100093966-100093988 AGATGTGAGTTGGAGTAGTGTGG + Intronic
935237542 2:101151272-101151294 AGATGTGAGCTGGGGCCGGCGGG - Intronic
936124004 2:109771196-109771218 AGATGTGAGTTGGAGTAGTGTGG - Intergenic
936220685 2:110600268-110600290 AGATGTGAGTTGGAGTAGTGTGG + Intergenic
936455259 2:112668238-112668260 AATTGTGAGGTCGAGGTGGGTGG - Intergenic
936557353 2:113508291-113508313 AGAAAGAAGCTGGAGGTGGGGGG + Intergenic
937116159 2:119406501-119406523 GAATATGAGCTGGAAGTGGGAGG + Intergenic
937180835 2:119994960-119994982 ACATGGGAGCTTGAGGTGGGAGG - Intergenic
937275863 2:120683736-120683758 AGATGTGAGCAGGTGTTGCGTGG + Intergenic
937381317 2:121380038-121380060 AACTGTGAGCTGCAGGTGAGAGG + Intronic
937842446 2:126537143-126537165 TGATGTGGGCTGGGGGTTGGAGG + Intergenic
937862110 2:126719296-126719318 TTCTGTGAGCTGGTGGTGGGGGG - Intergenic
937908447 2:127064084-127064106 AGGGGTGGGCAGGAGGTGGGAGG - Intronic
937913983 2:127089986-127090008 TTATGTGAGCTGGGGGTTGGGGG - Intronic
938309882 2:130282739-130282761 AGATATGAGATGGAGTGGGGAGG - Intergenic
938426081 2:131189249-131189271 AGATGTGGGCAGGAGTTTGGGGG + Intronic
938445035 2:131369630-131369652 AGATATGAGATGGAGTGGGGAGG + Intergenic
939046066 2:137251694-137251716 AGATCTGAGCTGAAGGTTTGTGG - Intronic
939267209 2:139889632-139889654 GTATGTGTGCTGGTGGTGGGAGG - Intergenic
940777734 2:157902367-157902389 ACTTGGGAGGTGGAGGTGGGAGG - Intronic
940960457 2:159779710-159779732 ACATGGGAGCCTGAGGTGGGAGG - Intronic
942034996 2:172001985-172002007 ACTTGGGAGGTGGAGGTGGGAGG + Intronic
942038602 2:172035755-172035777 ACTTGGGAGGTGGAGGTGGGAGG - Intronic
942341163 2:174949425-174949447 ACTTGGGAGGTGGAGGTGGGAGG - Intronic
942341173 2:174949463-174949485 ACTTGGGAGGTGGAGGTGGGAGG - Intronic
942541144 2:177016597-177016619 AGATGGGAGGCTGAGGTGGGAGG + Intergenic
942651628 2:178174753-178174775 ACTTGTGAGAAGGAGGTGGGAGG + Intergenic
943981061 2:194550960-194550982 AGAAGTGTGCTGGGGTTGGGAGG + Intergenic
944084398 2:195827687-195827709 CTATGTGAGGTTGAGGTGGGAGG - Intronic
944646497 2:201785791-201785813 ACTTGGGAGCTTGAGGTGGGAGG - Intergenic
944775850 2:202963694-202963716 AGGTCTGAGCTGGAGGTGATCGG + Intronic
945071042 2:205989271-205989293 AGATGTGAGCGGCAGGGGAGAGG - Intergenic
946223775 2:218251077-218251099 AGATGGGAGGCCGAGGTGGGTGG - Intronic
946236313 2:218326635-218326657 TGATGTGGCCTGGAGTTGGGTGG + Intronic
946433732 2:219638877-219638899 AGATGGGAGGAGGAGGTGGGAGG + Intronic
946590437 2:221241264-221241286 AGAAGAGAGCTGGAGCTGGCAGG + Intergenic
947153592 2:227138207-227138229 ACTTGGGAGGTGGAGGTGGGAGG + Intronic
947590080 2:231380391-231380413 AGATGAGAGCTGCCGGTGGCTGG + Intergenic
948314496 2:237016916-237016938 AGATGCTAGCAGAAGGTGGGAGG - Intergenic
948553319 2:238790628-238790650 ACATGGGGGCTGGAGATGGGGGG + Intergenic
948777322 2:240296561-240296583 AGATAAGTGCTGGGGGTGGGGGG + Intergenic
1170706019 20:18745494-18745516 AGGTGTGGGGTGGAGATGGGAGG + Intronic
1171123585 20:22584451-22584473 GGAAGTGGGCGGGAGGTGGGGGG + Exonic
1171344001 20:24452160-24452182 AGATATGACCTTGAGGTGTGGGG + Intergenic
1171361426 20:24588955-24588977 AGCTGTGGGGTGGGGGTGGGTGG + Intronic
1171736156 20:28788460-28788482 AGATGTGGGGTGGGGGAGGGGGG - Intergenic
1172453485 20:35046821-35046843 AGAAGTGGGCTGGGGGTGGTGGG - Intronic
1172874751 20:38157248-38157270 ACATTTGAGCTGGGTGTGGGTGG - Intronic
1173422881 20:42918286-42918308 AGCTGTTACCTGGAGATGGGGGG - Intronic
1173578974 20:44132844-44132866 GGATGAGAGCTGCAGGTGTGGGG - Intronic
1173904011 20:46612893-46612915 AGGTGGGAGTTGAAGGTGGGGGG - Intronic
1173949537 20:46979247-46979269 AGATGACAGCTGGAGGGTGGGGG - Intronic
1174214606 20:48906511-48906533 AGCTGTGAGCTGGATGTTGAAGG - Intergenic
1174429387 20:50456692-50456714 AGAGCTGAGTGGGAGGTGGGAGG - Intergenic
1174772685 20:53315901-53315923 AGCTGAGCTCTGGAGGTGGGTGG + Intronic
1175653178 20:60746620-60746642 AGAAGTCAGCTGGAGGAGGGTGG + Intergenic
1175892860 20:62323061-62323083 GGATGTGATCGTGAGGTGGGGGG + Intronic
1176085024 20:63292016-63292038 AGAGATGAGCTGGAGGTGCTCGG - Intergenic
1176664238 21:9669602-9669624 ACATGTGAGGTGGAGGAGGAAGG - Intergenic
1177785484 21:25666772-25666794 ATTTGAGAGATGGAGGTGGGAGG - Intronic
1178778475 21:35575657-35575679 AGATGTGGGGTGGAGGTAAGAGG + Intronic
1179076988 21:38131777-38131799 AGATGTGCCCTGGAGGGGTGGGG - Intronic
1179714341 21:43279979-43280001 TGAGGTGAGGTGGAGGTGGAGGG + Intergenic
1179714668 21:43280728-43280750 AGAGGGGAGGTGGAGGTGGGGGG + Intergenic
1179714746 21:43280907-43280929 AGAGGGGAGGTGGAGGTAGGGGG + Intergenic
1179714767 21:43280950-43280972 AGAGGGGAGGTGGAGGTAGGGGG + Intergenic
1180467254 22:15623402-15623424 AGATGTGGGCAGGAGTTTGGGGG + Intergenic
1180748780 22:18110655-18110677 AGATTTGAGCCGCGGGTGGGCGG + Intronic
1180838764 22:18947989-18948011 AGGTGGGAGTTGGCGGTGGGGGG + Intergenic
1180845834 22:18981593-18981615 AGTTGTGAGGCTGAGGTGGGAGG - Intergenic
1180901240 22:19374878-19374900 AGATGTGGGCTGGACTTTGGGGG - Intronic
1181630297 22:24147598-24147620 AGATGTGCGCTGGGTGTGGTGGG - Intronic
1181936487 22:26442476-26442498 GGCTGTGAGCTGGTGGTGGGGGG + Exonic
1182133469 22:27877747-27877769 GGAAGTGAGTAGGAGGTGGGGGG + Intronic
1182353319 22:29710926-29710948 TGCAGGGAGCTGGAGGTGGGGGG - Intergenic
1182470507 22:30545208-30545230 AGCTATGAGCTGGAGGAGGCAGG - Intronic
1182555686 22:31127256-31127278 AGATGTGGGTGGAAGGTGGGTGG - Intronic
1182776424 22:32834558-32834580 AGATGTGCAGTGGAGGTGGCAGG + Intronic
1183327638 22:37203121-37203143 AGTTGTGAGCAGGAGCAGGGAGG - Intergenic
1183329555 22:37212065-37212087 GGATGTGTCCTGGAGATGGGGGG - Exonic
1183567852 22:38629205-38629227 AGGTGAGAGCTGGAGGTAGTTGG - Intronic
1183604651 22:38861289-38861311 ACATGTGAGCTGGGGGAGTGTGG + Intergenic
1183976032 22:41512919-41512941 AGGTCTGGGATGGAGGTGGGGGG - Intronic
1184683314 22:46084754-46084776 AGAGGTGAGCTGGTGTTTGGAGG + Intronic
1184781482 22:46651831-46651853 AGGGCGGAGCTGGAGGTGGGGGG + Intronic
1185083961 22:48726338-48726360 AAATGAGACCTGGAGGTGGGGGG + Intronic
1185112161 22:48906110-48906132 AGAAGTCAACTGGAGTTGGGAGG - Intergenic
1203254984 22_KI270733v1_random:133535-133557 AGACGTGGGGTGGGGGTGGGGGG - Intergenic
1203263040 22_KI270733v1_random:178614-178636 AGACGTGGGGTGGGGGTGGGGGG - Intergenic
950219563 3:11184151-11184173 AGATTTGAGTTGGAGGTGGAAGG - Intronic
950406185 3:12806563-12806585 AGATGTGGCCTGGAGGGGGTTGG - Intronic
950547198 3:13645586-13645608 AGCTGTGAGTTGGAGGTTGGTGG + Intergenic
950672058 3:14533089-14533111 TGATGTGAACTGGAGGTGGAAGG - Intronic
950697869 3:14717552-14717574 TGGTGTCAGGTGGAGGTGGGAGG + Intronic
950876879 3:16283640-16283662 AGTTGTCAGCAGAAGGTGGGAGG + Intronic
952184163 3:30950710-30950732 AGCTGGGAGCTGGGAGTGGGGGG + Intergenic
952196421 3:31080336-31080358 ATATGTAAGTGGGAGGTGGGTGG - Intergenic
952375478 3:32763714-32763736 AGGTTTGAGATGGTGGTGGGTGG + Intronic
952402821 3:32978656-32978678 AGATCTGAGATGGTGGTGAGAGG + Intergenic
952912268 3:38201147-38201169 ACTTGTGAGATTGAGGTGGGAGG - Intronic
953335285 3:42089286-42089308 AGGTGTGAGATGGGGGTGGCTGG - Intronic
954154576 3:48678379-48678401 TGAGGTGATCTGGAGGTGGTGGG - Intronic
954295031 3:49669624-49669646 AGATCTGGGCTGGAGCTAGGGGG + Exonic
954635425 3:52068424-52068446 GGAAGGGAGCAGGAGGTGGGAGG + Intergenic
954856811 3:53650956-53650978 AAATGGGAGGTGGAGGTTGGGGG + Intronic
954872839 3:53780787-53780809 AGGAGTGACCAGGAGGTGGGGGG + Intronic
955271585 3:57505241-57505263 AGAAGTGGGCGGGGGGTGGGGGG - Intronic
955607074 3:60716480-60716502 GGATGAGATGTGGAGGTGGGAGG - Intronic
955687880 3:61563367-61563389 AGCTGAGAGCTGGAAGTGGAGGG - Intronic
955816160 3:62845695-62845717 AGATGATAGTGGGAGGTGGGAGG - Intronic
957055582 3:75440214-75440236 AGATGGAAGGTGGCGGTGGGGGG + Intergenic
957387084 3:79510138-79510160 AGATGAGATTTGGTGGTGGGGGG - Intronic
958994292 3:100884644-100884666 AGATGTGTGCTTGAGGTGTGTGG - Intronic
959539730 3:107524786-107524808 CGAGGTGGGGTGGAGGTGGGGGG + Intronic
960148560 3:114229008-114229030 AGATGTCACGGGGAGGTGGGGGG + Intergenic
960575005 3:119220653-119220675 AGGGGTGAGCTGGAGTGGGGAGG + Intronic
960950157 3:122993942-122993964 ACAGGTGGGCTTGAGGTGGGGGG - Intronic
961082407 3:124037633-124037655 AAAAGTGATCTGGAGGTGAGGGG + Intergenic
961167265 3:124772064-124772086 TGCTGGGAGCTGGAGGTTGGGGG + Intronic
961329951 3:126132500-126132522 CGATGTGAGGAGGAGGAGGGAGG - Intronic
962817778 3:139018135-139018157 AGATGGGAGGCTGAGGTGGGTGG - Intronic
963541473 3:146595502-146595524 AGGAGAGAGGTGGAGGTGGGAGG + Intronic
963783902 3:149513679-149513701 AGATATTTGGTGGAGGTGGGGGG + Intergenic
964622004 3:158727876-158727898 AAGTGCTAGCTGGAGGTGGGTGG - Intronic
965293312 3:166911649-166911671 AGTTGTGAGGCTGAGGTGGGAGG + Intergenic
967304155 3:188044502-188044524 AGGTGAAAGCTGAAGGTGGGGGG + Intergenic
967329581 3:188277145-188277167 CGTTGTGAGGTGGAGGCGGGTGG - Intronic
967633880 3:191778292-191778314 AGATGTGGGGTGGGGGTTGGGGG + Intergenic
967703256 3:192619485-192619507 AGATGTCAGCAGGAGGTGCTCGG - Intronic
967978856 3:195053111-195053133 AGGTGGGAGCGGGAGGTGGGAGG - Intergenic
968575188 4:1362737-1362759 AGAGGTGAACTGGAGGCGTGTGG + Intronic
968793328 4:2684734-2684756 AGAAGCGAGGTGGAGGTGAGGGG - Intronic
969221521 4:5762047-5762069 TGATGTGGGGTGGGGGTGGGGGG - Intronic
969348806 4:6586155-6586177 ACTTGGGAGGTGGAGGTGGGAGG - Intronic
969755606 4:9148132-9148154 AGATGGCAGGTGGCGGTGGGGGG - Intergenic
970284793 4:14499688-14499710 AGATGTGATTGGGATGTGGGAGG - Intergenic
970377246 4:15471371-15471393 AGATTGGAGCTGAAGGTGGGTGG + Intronic
970403518 4:15740521-15740543 AGATGAGAGGTGAAGGTGTGAGG + Intergenic
972713236 4:41619550-41619572 AGATTACAGATGGAGGTGGGTGG + Intronic
973022454 4:45220407-45220429 AGACGGGAGCTGGAGAGGGGAGG + Intergenic
973334378 4:48941605-48941627 AGATGTAAGCTTGAGGAAGGCGG - Intergenic
974015557 4:56645790-56645812 ACATGTGAGGCTGAGGTGGGAGG - Intergenic
974764317 4:66322511-66322533 AGAGGTAAACTGGAGGTGAGGGG + Intergenic
974790621 4:66683384-66683406 AGTTGTGAGCCTGAGGTGGGAGG - Intergenic
975054198 4:69907726-69907748 ATATGGGAGATGGAGGTAGGAGG - Intergenic
975723285 4:77268735-77268757 AGAAGTGAGATGGAGGAGGGAGG + Intronic
976111841 4:81683758-81683780 AAATGTGACCTGCAGCTGGGAGG - Intronic
976145701 4:82041125-82041147 AGACTGGGGCTGGAGGTGGGGGG + Intronic
976682729 4:87775067-87775089 TGTTGTGGGGTGGAGGTGGGGGG + Intergenic
977234925 4:94496596-94496618 ACTTGGGAGGTGGAGGTGGGAGG - Intronic
977588340 4:98800048-98800070 ACCTGGGAGGTGGAGGTGGGAGG + Intergenic
977798091 4:101192508-101192530 AGAGGTGGGGTGGAGATGGGAGG - Intronic
978336180 4:107672066-107672088 AAAAATGAGATGGAGGTGGGTGG + Intronic
978622878 4:110651770-110651792 GGATGTGAACTGGTGGTGGTGGG + Intergenic
979412427 4:120395462-120395484 AGATGAGATTTGGTGGTGGGGGG + Intergenic
979689655 4:123547153-123547175 AGTTGGGGGCTGGAGGGGGGAGG - Intergenic
980048838 4:128018528-128018550 ACATGGGAGGTTGAGGTGGGAGG + Intronic
981087289 4:140697271-140697293 ACCTGGGAGGTGGAGGTGGGAGG + Intronic
982743268 4:159080323-159080345 ACTTGGGAGGTGGAGGTGGGAGG - Intergenic
983259298 4:165438151-165438173 AGATCAGTTCTGGAGGTGGGAGG + Intronic
984114535 4:175663365-175663387 AGAAGTGAGCTGGAGGTGATGGG + Intronic
984521856 4:180811384-180811406 ACATGTGAGGCTGAGGTGGGAGG + Intergenic
984731889 4:183076098-183076120 AGCTGTGAGATGGAGATGAGGGG + Intergenic
984924834 4:184797495-184797517 GCATGTGAGCTGGAGGTCTGTGG + Intronic
985256150 4:188071875-188071897 AGGAGTGAGGTGAAGGTGGGAGG + Intergenic
985707020 5:1407325-1407347 ACATGAGAGATGGACGTGGGAGG + Intronic
985776082 5:1843049-1843071 CGGTGTGTGCTGGGGGTGGGTGG + Intergenic
985776126 5:1843261-1843283 TGATATGTGCTGGGGGTGGGTGG + Intergenic
985920106 5:2964248-2964270 ACATGTGAACAGGAAGTGGGTGG - Intergenic
986543848 5:8874100-8874122 GACAGTGAGCTGGAGGTGGGGGG - Intergenic
986587134 5:9330145-9330167 AGATGGGAGGCCGAGGTGGGCGG + Intronic
986643016 5:9890393-9890415 AGATGTGAGGCGGAGGAGGAAGG - Intergenic
988696682 5:33628277-33628299 AGTTCAGAGCTGGAAGTGGGTGG + Intronic
989282566 5:39662372-39662394 ACTTGGGAGATGGAGGTGGGAGG - Intergenic
990820491 5:59834272-59834294 AGATGGGAGGTGGGAGTGGGGGG - Intronic
991021369 5:61983269-61983291 AGAGGTGGGGTGCAGGTGGGAGG + Intergenic
991166627 5:63570532-63570554 TCAGGTGAGCTGGGGGTGGGGGG + Intergenic
992104726 5:73440548-73440570 AGGTGTGGGGTGGAGGTGGGTGG - Intergenic
993049663 5:82912119-82912141 AGATGGGAGCTGGAGGAGGTGGG - Intergenic
993139177 5:84008703-84008725 AAAAGTGAGTAGGAGGTGGGAGG + Intronic
993141018 5:84033593-84033615 ACTTGTGAGGTTGAGGTGGGAGG + Intronic
993170875 5:84417488-84417510 ACATGGGAGCCTGAGGTGGGAGG + Intergenic
993588533 5:89763339-89763361 ACATGAGAGGTTGAGGTGGGAGG + Intergenic
995553084 5:113299773-113299795 AGGTGTGGGCAGGAGGTGGCAGG + Intronic
995650102 5:114361147-114361169 AAATGTGAGCTGGCGGTAGCGGG + Exonic
995793029 5:115914202-115914224 AGATGAGATCTGGAGTGGGGGGG + Intergenic
996327453 5:122291541-122291563 AGTTGTGAGCTGGTAGGGGGTGG + Intergenic
997298530 5:132785149-132785171 TGATATGAGCTGGAGCTGGGTGG - Intronic
997305476 5:132832684-132832706 AGAGGTGAGTGGTAGGTGGGTGG - Intergenic
997305490 5:132832778-132832800 AGAGGTGAGTGGTAGGTGGGTGG - Intergenic
997305503 5:132832871-132832893 AGAGGTGAGCGGTAGGTGGGTGG - Intergenic
997435712 5:133873372-133873394 AGATGGGAGCAGGGGGTGAGGGG + Intergenic
997778137 5:136629755-136629777 AGGTGAGGGCTGGGGGTGGGGGG - Intergenic
998006915 5:138663167-138663189 AGATGGCAGCTGGAGATAGGAGG - Intronic
998143529 5:139712626-139712648 AGATGTGAGGAGGAGGGGGCAGG + Intergenic
998144132 5:139716633-139716655 AGATGGGGGCTAGTGGTGGGGGG - Intergenic
998945485 5:147335368-147335390 AGATGTGTGCTGGACTTGGAGGG + Intronic
999246958 5:150160129-150160151 AGTTGTGGGGTGGGGGTGGGGGG + Intergenic
999666283 5:153916817-153916839 AGATCAGAGCTGGAGGTAGCTGG + Intergenic
1000216612 5:159163635-159163657 AGATCAGGGCTGGAGGAGGGAGG - Intronic
1001333872 5:170782338-170782360 AGCTGGGAGGTGGGGGTGGGAGG - Intronic
1001631458 5:173178537-173178559 AGAGGTGAGCGGGAGGCCGGGGG + Intergenic
1003255873 6:4474496-4474518 AGATGTCAGCAGGAGGTGTGGGG - Intergenic
1003425267 6:5994777-5994799 AGTGGTGAGCTGGGGGTGGGGGG - Intergenic
1003564747 6:7213600-7213622 GGATGTGGGCTTGTGGTGGGTGG + Intronic
1004233539 6:13853431-13853453 AGATGAGAGATGGAGGTAGGGGG + Intergenic
1004382517 6:15144830-15144852 AGGTGTGAGCCTGAGGTGGGAGG - Intergenic
1004465870 6:15884162-15884184 ACCTGTGAGGTTGAGGTGGGAGG + Intergenic
1005658400 6:27967289-27967311 AGCTGTGGGCTGGAGTGGGGTGG - Intergenic
1006418488 6:33919162-33919184 AGATGTGAGCAGAAGGTGTGAGG - Intergenic
1006551994 6:34832054-34832076 ATTTGGGAGGTGGAGGTGGGTGG - Intronic
1006738770 6:36292962-36292984 AGGTCTGGGCTGGTGGTGGGTGG + Intronic
1006750464 6:36373570-36373592 GGACGTCACCTGGAGGTGGGTGG + Exonic
1007055993 6:38885382-38885404 AGAAGAGAGCTGGTGGTGGGTGG - Intronic
1007135015 6:39512435-39512457 AGGTATGGGCTGCAGGTGGGAGG - Intronic
1007321500 6:41031662-41031684 GGATGTGAGTTGGAGCTGAGGGG - Exonic
1007446101 6:41907353-41907375 AGATGGGAGCAGGAGGCAGGAGG - Intronic
1007709210 6:43811227-43811249 TGATTTAAGCTGGGGGTGGGTGG + Intergenic
1007746159 6:44044087-44044109 AGCTGGGAGCTGGGGGAGGGGGG - Intergenic
1008737866 6:54569229-54569251 AGATGTGGGGTGGAGGGGGCGGG - Intergenic
1008737883 6:54569303-54569325 AGATGTGGGGTGGAGGGGGCGGG - Intergenic
1010215038 6:73394095-73394117 CTATGGGAGGTGGAGGTGGGAGG + Intronic
1010220386 6:73443594-73443616 ATGTGGGAGATGGAGGTGGGGGG - Intronic
1010222360 6:73458892-73458914 ATTTGGGAGATGGAGGTGGGAGG + Intergenic
1010717231 6:79243701-79243723 ATGTGTGAGTGGGAGGTGGGAGG + Intergenic
1011083065 6:83510495-83510517 ACCTGGGAGGTGGAGGTGGGAGG + Intergenic
1011753024 6:90472431-90472453 AGTTGAGAGGTGGAGGTGGGAGG + Intergenic
1012046939 6:94288405-94288427 GCATATGAGCTGGTGGTGGGAGG + Intergenic
1013169122 6:107620250-107620272 AGAAGGGAGCTGGAAGTGGATGG - Intronic
1013613251 6:111815823-111815845 AGCTGTGAGGCTGAGGTGGGAGG - Intronic
1014256160 6:119161646-119161668 AGATGTCAGCTGGAGGTGCCGGG + Intergenic
1014323889 6:119966968-119966990 ACATGGGAGGTTGAGGTGGGAGG - Intergenic
1016047646 6:139497009-139497031 AGATGTGAGCTGGACATGACTGG + Intergenic
1016291087 6:142528892-142528914 AAATGTGAGCTGAAGGGGGATGG - Intergenic
1016993216 6:149943441-149943463 AGGTGTGAGCTGAGGGTGAGGGG + Intronic
1017005117 6:150024090-150024112 AGGTGTGAGCTGAGGGTGAGTGG - Intronic
1017011728 6:150068144-150068166 AGGTGTGACCTGAGGGTGGGGGG - Intronic
1017058069 6:150455761-150455783 AGGTGTGAGCAGGGAGTGGGTGG - Intergenic
1017791603 6:157804825-157804847 GGATGTGAGCTGGAGCGTGGAGG + Intronic
1018621084 6:165730506-165730528 CTTTGGGAGCTGGAGGTGGGTGG + Intronic
1018683615 6:166284659-166284681 AGAGATGGGCTGGAGATGGGTGG - Intergenic
1019103348 6:169649814-169649836 AGATGAGAGATGGATGTGTGAGG - Intronic
1019414826 7:922361-922383 AAATGTGAGCTGGGGGCAGGGGG + Intronic
1020192198 7:6008989-6009011 AGCTGAGAGCTCGAGGTGAGCGG - Exonic
1020251838 7:6475316-6475338 ACATGGGAGGTTGAGGTGGGAGG + Intronic
1020460613 7:8425849-8425871 AGATGTGTGTTGGGGGTGGGGGG + Intergenic
1020865395 7:13554842-13554864 AGACATGGGCTGGAGGTGGTAGG - Intergenic
1021013181 7:15497068-15497090 AGATATGAGCTGGAAGTCAGAGG + Intronic
1021414116 7:20362171-20362193 AGTTCTGACCTGGAGGTGGAAGG - Intronic
1022300063 7:29094673-29094695 AGATGGGAGCGTGGGGTGGGGGG - Intronic
1022510855 7:30933983-30934005 AGATGAGAGCTGGAGGTGATGGG + Intergenic
1022937754 7:35197783-35197805 ATATGTGTGCTGGGGGTGGGGGG - Intergenic
1023490858 7:40739616-40739638 ACATGTGTACTGGAGCTGGGGGG - Intronic
1023788879 7:43736320-43736342 AGATGTGAGGCTGAGGTGAGAGG + Intergenic
1023878724 7:44306865-44306887 AGGTGTGAGCAGGAGGAGGAGGG + Intronic
1024282743 7:47732930-47732952 CGCTGGGAGGTGGAGGTGGGTGG + Intronic
1024645394 7:51366704-51366726 AGTTGGGAGTTGGAGGTTGGAGG + Intergenic
1024936803 7:54719303-54719325 GGATGTGAGGTGGGGGTAGGTGG - Intergenic
1025800328 7:64780762-64780784 GGAGCTGAGGTGGAGGTGGGAGG - Intergenic
1026025020 7:66737747-66737769 ACTTGTGAGCCTGAGGTGGGAGG + Intronic
1026420895 7:70235899-70235921 AGATGGGAGCCCAAGGTGGGCGG - Intronic
1026515500 7:71067313-71067335 TAATGTGAGAGGGAGGTGGGGGG - Intergenic
1026527921 7:71171956-71171978 ATAGGTGGGCTGGGGGTGGGAGG - Intronic
1026874544 7:73871790-73871812 AGATGTGAGCCTGGGGTGAGGGG - Intergenic
1026913346 7:74105655-74105677 AGGTGTGAGCTGGAGAAAGGTGG - Intronic
1027170323 7:75867013-75867035 AGATGTGCAGTGGAGGTTGGGGG + Intronic
1027414887 7:77964189-77964211 ACATGGGAGGTGGAGATGGGAGG + Intergenic
1028086744 7:86645184-86645206 AGAGCTGAGATGGAGGTGGTTGG - Intronic
1028940712 7:96519488-96519510 AGATGTGAAGTGGGAGTGGGTGG + Intronic
1029085991 7:98012203-98012225 AGATGAGAGGCTGAGGTGGGAGG - Intergenic
1029100275 7:98124194-98124216 AGATGTGAGGTGAAGCTGGAGGG - Intronic
1029420722 7:100470544-100470566 AGATGGGAGGCTGAGGTGGGTGG - Intronic
1029709719 7:102293013-102293035 GGGTGCCAGCTGGAGGTGGGCGG + Intronic
1030185927 7:106761714-106761736 ATTTGGGAGGTGGAGGTGGGCGG + Intergenic
1030631095 7:111896681-111896703 AGATCTGAGCTGGAGGAGTTAGG + Intronic
1030746084 7:113167767-113167789 AGATGAGAGAGGGAGGTGGGTGG + Intergenic
1032275640 7:130452964-130452986 ATATGTGAGCAGAAGGGGGGTGG + Intergenic
1033013794 7:137650967-137650989 ATGTGGGAGCTGGAGGTGGCTGG + Intronic
1033032883 7:137844893-137844915 AGCTGTGAGTTGGAAGGGGGTGG - Intronic
1033280807 7:140005061-140005083 AGCTGAGAGCTGGTCGTGGGAGG + Intronic
1033832772 7:145273234-145273256 AGAAGTGAGTGGGAGGTGAGTGG - Intergenic
1036129193 8:6092269-6092291 AGTTGGGCGCTGGATGTGGGGGG - Intergenic
1036135854 8:6160977-6160999 AGAGGGGAGCAGGAGGTGGGAGG - Intergenic
1036643818 8:10600060-10600082 AGAGGGGAGCAGGATGTGGGTGG - Intergenic
1037522648 8:19695012-19695034 AGGAGTGAGCTGTAGATGGGGGG - Intronic
1037546619 8:19930078-19930100 AGATGTGAGTGGGTGGTGGTGGG + Intronic
1038229402 8:25686205-25686227 AATTGGGAGGTGGAGGTGGGTGG + Intergenic
1038305983 8:26402679-26402701 ACTTGGGAGGTGGAGGTGGGAGG + Intronic
1038311601 8:26449646-26449668 AGGGGTGAGCAGGAGGAGGGAGG + Intronic
1038315871 8:26483903-26483925 AGATGGGAGCAGGAGGGAGGAGG + Intronic
1038390899 8:27199834-27199856 AGATGGGAGGTCAAGGTGGGAGG - Intergenic
1038653053 8:29423005-29423027 AGATGGGAACTTGAGGTGGTGGG - Intergenic
1039019799 8:33192433-33192455 AGATGGGAGACTGAGGTGGGTGG - Intergenic
1040399131 8:47030488-47030510 AGATGGTAGCTGGGGGTTGGGGG + Intergenic
1040620025 8:49081760-49081782 TGCTGGGAGGTGGAGGTGGGAGG + Intergenic
1040915284 8:52562608-52562630 AGATGTGAGCTGGAGGTGGGGGG - Intronic
1041307948 8:56482994-56483016 ACTTGGGAGTTGGAGGTGGGTGG + Intergenic
1042192266 8:66198916-66198938 ATGTGTGAGGTGGGGGTGGGTGG - Intergenic
1042309881 8:67369443-67369465 ATATGTGTGGTGGGGGTGGGGGG - Intergenic
1042830270 8:73019203-73019225 AGATGTGGTGTGGGGGTGGGGGG + Intronic
1042886179 8:73554495-73554517 AGCTGGGAGCTGGGGGTGGAGGG + Intronic
1042947491 8:74169832-74169854 ATGTGTGGGCTGGGGGTGGGAGG + Intergenic
1043515861 8:80994053-80994075 AGATGAGAGATGGCAGTGGGGGG - Intronic
1043517791 8:81012075-81012097 ACATGTCAGCTTGAGATGGGAGG + Intronic
1046759938 8:118010423-118010445 AGAGGTGAAATAGAGGTGGGGGG - Intronic
1046947864 8:119991271-119991293 AGGGGTAAGGTGGAGGTGGGAGG - Intronic
1048863217 8:138739270-138739292 AGATTCAAGGTGGAGGTGGGAGG - Intronic
1049712999 8:144075169-144075191 ACTTGGGAGGTGGAGGTGGGAGG - Intergenic
1049895650 9:109008-109030 AGAAAGAAGCTGGAGGTGGGGGG - Intergenic
1049938275 9:520227-520249 ACCTGGGAGGTGGAGGTGGGAGG + Intronic
1049941077 9:546480-546502 GGGTGATAGCTGGAGGTGGGTGG + Intronic
1050412920 9:5385025-5385047 TGAGGTCAGATGGAGGTGGGTGG + Intronic
1051148166 9:14051766-14051788 GGATGTGAGCTGGGGGTTGTGGG + Intergenic
1051473927 9:17481535-17481557 AGATGTACGCTGCAGTTGGGTGG - Intronic
1051646713 9:19275712-19275734 CTATGGGAGGTGGAGGTGGGTGG - Intronic
1051667709 9:19481031-19481053 AGTTGGGAGGCGGAGGTGGGAGG - Intergenic
1051724876 9:20078625-20078647 AGAAGGGAGATGGAGGTGGGTGG - Intergenic
1052251741 9:26406708-26406730 AGCTGAGAGCTGCAGGTAGGTGG - Intergenic
1052384040 9:27804325-27804347 AGAGGAAAGCTGGAGATGGGAGG + Intergenic
1052734939 9:32332331-32332353 AGATGTGAGAAGGAGTTGAGAGG + Intergenic
1053161829 9:35818739-35818761 AGATGTGGGATGCAGGTAGGTGG + Intronic
1053504604 9:38630940-38630962 ACTTGGGAGGTGGAGGTGGGAGG + Intergenic
1053738827 9:41119186-41119208 AGAAAGAAGCTGGAGGTGGGGGG - Intergenic
1053932266 9:43121935-43121957 ACATGGGAGCTGGAGTTGGATGG + Intergenic
1054689517 9:68312129-68312151 AGAAAGAAGCTGGAGGTGGGGGG + Intergenic
1054925641 9:70586031-70586053 AGATGAGAGCAGGAGGTGTAAGG - Intronic
1055612680 9:78039044-78039066 AGAGGTGGGTTGGGGGTGGGAGG - Intergenic
1055730381 9:79274475-79274497 AGATGTAAGCTGTAGGTGGATGG + Intergenic
1056789447 9:89616196-89616218 AGATGTGGGCTGCCCGTGGGGGG + Intergenic
1056814319 9:89790498-89790520 AGAACTGAGCTGGAGGAGGTAGG - Intergenic
1058478169 9:105362380-105362402 AGATGGGATGTGGGGGTGGGAGG + Intronic
1058605052 9:106712200-106712222 AGATGTGAGATGGACCTAGGAGG - Intergenic
1058928461 9:109692903-109692925 AAAAGAGAGATGGAGGTGGGGGG - Intronic
1059559154 9:115315331-115315353 AGATGTGAGGCCGAGGTGGGTGG - Intronic
1059578087 9:115513416-115513438 AGATGTGAGCTGGAGAAATGAGG - Intergenic
1059873473 9:118604268-118604290 AGTTGTGAGGAGGAGGTGGGAGG + Intergenic
1060115397 9:120936402-120936424 GGGTGGGAGATGGAGGTGGGTGG - Intergenic
1060880879 9:127117208-127117230 ACTTGTGAGCTGAAGGAGGGAGG - Intronic
1060907339 9:127318664-127318686 AGAGATGAGAGGGAGGTGGGAGG - Intronic
1061192127 9:129088119-129088141 ACGTGGGAGCTGGGGGTGGGGGG + Intronic
1061461995 9:130747267-130747289 ACATGGGAGGTTGAGGTGGGAGG + Intronic
1061557569 9:131381122-131381144 ACATGTGAGGTGGAGGTGGTAGG - Intergenic
1061674601 9:132208594-132208616 TGATGGGAGCAGGCGGTGGGAGG + Intronic
1061807965 9:133147102-133147124 CCAAGTGAGCTGGGGGTGGGAGG - Intronic
1062016929 9:134295743-134295765 AGAGGAGAGCTGGAGGCCGGTGG - Intergenic
1062016935 9:134295770-134295792 AGAGGGGAGCTGGAGGCCGGCGG - Intergenic
1062016943 9:134295797-134295819 AGAGGGGAGCTGGAGGCCGGTGG - Intergenic
1062016951 9:134295824-134295846 AGAGGGGAGCTGGAGGCCGGTGG - Intergenic
1062142628 9:134968159-134968181 AGATTTCAGCAGGATGTGGGCGG + Intergenic
1062661364 9:137636161-137636183 CTCTGGGAGCTGGAGGTGGGTGG - Intronic
1203661863 Un_KI270753v1:52150-52172 ACATGTGAGGTGGAGGAGGAAGG + Intergenic
1185866592 X:3629760-3629782 ACATGGGAGCCTGAGGTGGGAGG - Intronic
1186677731 X:11836543-11836565 AGATGGGAGCTAGAGGAGGCAGG + Intergenic
1186858818 X:13651592-13651614 AGATGTCACCTGGAGGTTGGTGG - Intergenic
1187208509 X:17206139-17206161 GTCTGGGAGCTGGAGGTGGGTGG - Intergenic
1187261205 X:17686734-17686756 AGATGAGACTGGGAGGTGGGGGG + Intronic
1187428936 X:19203907-19203929 AGATGGGAGGCTGAGGTGGGAGG - Intergenic
1187551433 X:20309824-20309846 AAATGTGATGTGGAGGCGGGAGG + Intergenic
1188082948 X:25867035-25867057 CAATGTGAGTTGGGGGTGGGAGG - Intergenic
1190028949 X:46953212-46953234 AGTGGTGAGGTGGCGGTGGGGGG - Intronic
1190558618 X:51664699-51664721 AGGTGTGAGGTTGGGGTGGGGGG - Intergenic
1190704734 X:53017847-53017869 ACTTGGGAGGTGGAGGTGGGAGG - Intergenic
1192119877 X:68445404-68445426 ACTTGGGAGGTGGAGGTGGGAGG + Intergenic
1192238151 X:69309297-69309319 ACATGGGGGCTGTAGGTGGGTGG + Intergenic
1192360069 X:70433824-70433846 GGAGGTGGGTTGGAGGTGGGAGG + Intergenic
1193565377 X:83069806-83069828 GGATGGGAGCTGGAGGTTGAAGG - Intergenic
1194842805 X:98764942-98764964 ATATGAGAAGTGGAGGTGGGAGG + Intergenic
1195460625 X:105119509-105119531 ACAGCTGAGCTGGAGGTGTGGGG - Intronic
1195565002 X:106330452-106330474 AGAGGTGACCATGAGGTGGGTGG - Intergenic
1195702454 X:107715664-107715686 AGACCTGAGATGGAGGAGGGAGG + Intronic
1195863229 X:109403228-109403250 AAATCTGAGATGGGGGTGGGTGG - Intronic
1196205783 X:112937763-112937785 ACATGGGAATTGGAGGTGGGAGG + Intergenic
1197335323 X:125204467-125204489 AGATGGGAGGTGGAGGGAGGTGG + Intergenic
1198008188 X:132520853-132520875 AGATGTGAGCTGGAACAGGGTGG + Intergenic
1198549158 X:137726600-137726622 ACTTGGGAGGTGGAGGTGGGAGG - Intergenic
1198629363 X:138617694-138617716 ACTTGGGAGGTGGAGGTGGGAGG + Intergenic
1199735760 X:150685423-150685445 AGATGTCAGCTGGAGTTAGGGGG - Intergenic
1200117192 X:153774579-153774601 GGAAGTGTGCTGGGGGTGGGCGG - Intronic
1200256585 X:154585813-154585835 AGATGGGAGCGGGTGGCGGGAGG + Intronic
1200261184 X:154618590-154618612 AGATGGGAGCGGGTGGCGGGAGG - Intronic
1200787214 Y:7271759-7271781 AGATGGGGGCTGGGGGTGGGGGG + Intergenic
1200797279 Y:7352524-7352546 ACATGGGAGTTTGAGGTGGGAGG + Intergenic
1201375456 Y:13314013-13314035 AAATGTGAGCTAGATGTGAGAGG + Intronic