ID: 1040917247

View in Genome Browser
Species Human (GRCh38)
Location 8:52575093-52575115
Sequence ATAAAGTTTAGGTCAAATCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040917247_1040917251 1 Left 1040917247 8:52575093-52575115 CCCTGATTTGACCTAAACTTTAT No data
Right 1040917251 8:52575117-52575139 CAATATATGCATAGTGTGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040917247 Original CRISPR ATAAAGTTTAGGTCAAATCA GGG (reversed) Intergenic
No off target data available for this crispr