ID: 1040917249

View in Genome Browser
Species Human (GRCh38)
Location 8:52575104-52575126
Sequence GCATATATTGGATAAAGTTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040917249_1040917251 -10 Left 1040917249 8:52575104-52575126 CCTAAACTTTATCCAATATATGC No data
Right 1040917251 8:52575117-52575139 CAATATATGCATAGTGTGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040917249 Original CRISPR GCATATATTGGATAAAGTTT AGG (reversed) Intergenic
No off target data available for this crispr