ID: 1040919461

View in Genome Browser
Species Human (GRCh38)
Location 8:52600131-52600153
Sequence CCTTGCAGGGCTGTGTGATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040919461_1040919469 2 Left 1040919461 8:52600131-52600153 CCTCATCACACAGCCCTGCAAGG No data
Right 1040919469 8:52600156-52600178 AGGGGGCTTCTCTATGCCAGAGG No data
1040919461_1040919471 29 Left 1040919461 8:52600131-52600153 CCTCATCACACAGCCCTGCAAGG No data
Right 1040919471 8:52600183-52600205 TTTGTTTTTTTTTTTCCTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040919461 Original CRISPR CCTTGCAGGGCTGTGTGATG AGG (reversed) Intergenic
No off target data available for this crispr