ID: 1040923786

View in Genome Browser
Species Human (GRCh38)
Location 8:52653944-52653966
Sequence CTTCCCTTACTCGTGGAACA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040923780_1040923786 28 Left 1040923780 8:52653893-52653915 CCAGAATCGTTACTGGAATAGAC 0: 1
1: 0
2: 1
3: 6
4: 60
Right 1040923786 8:52653944-52653966 CTTCCCTTACTCGTGGAACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040923786 Original CRISPR CTTCCCTTACTCGTGGAACA AGG Intronic
No off target data available for this crispr