ID: 1040927362

View in Genome Browser
Species Human (GRCh38)
Location 8:52698610-52698632
Sequence CCTTATTAAAAGTTATTCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 285
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 263}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040927362_1040927365 15 Left 1040927362 8:52698610-52698632 CCAGAGAATAACTTTTAATAAGG 0: 1
1: 0
2: 1
3: 20
4: 263
Right 1040927365 8:52698648-52698670 AAAACTGTATATGTAATGGTTGG No data
1040927362_1040927364 11 Left 1040927362 8:52698610-52698632 CCAGAGAATAACTTTTAATAAGG 0: 1
1: 0
2: 1
3: 20
4: 263
Right 1040927364 8:52698644-52698666 AACAAAAACTGTATATGTAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040927362 Original CRISPR CCTTATTAAAAGTTATTCTC TGG (reversed) Intronic
900848277 1:5121103-5121125 TTTTATTAAATGTTATTCTGTGG + Intergenic
900951576 1:5861006-5861028 CCTTCTGAAAAGTTACTGTCCGG - Intergenic
903115323 1:21175177-21175199 CATGATGAAATGTTATTCTCAGG + Intronic
905815559 1:40948237-40948259 CTTTATTAAAAATTATTTTAAGG + Intergenic
907452775 1:54557587-54557609 CCTTGGTTAAATTTATTCTCAGG + Intronic
909338072 1:74499429-74499451 CTTTAATAAAAGTTATTGTGGGG - Intronic
909583144 1:77260574-77260596 CCTTTGTATAAGTTATTCTCTGG - Intergenic
909916638 1:81327602-81327624 CCTTATTAAAGTTTATTTTAGGG - Intronic
911279807 1:95910282-95910304 CCTTATTTAAATTTATTCTTAGG + Intergenic
912069408 1:105789984-105790006 CATTATTATAATTTATTTTCAGG - Intergenic
912200247 1:107449317-107449339 CCTTCTTAAGTGTGATTCTCTGG + Intronic
913019198 1:114770055-114770077 TTTTATTAAAAGTAATTCTCAGG + Exonic
913988820 1:143589916-143589938 CCTTGATAAAAATTATTCCCAGG + Intergenic
915056605 1:153138148-153138170 CCTTAGTTAAATTTATTCTTGGG - Intergenic
915427440 1:155838446-155838468 CATTATTCAAAGTTATTTCCTGG - Intronic
916971497 1:170022833-170022855 TATTATTAAAAGTTATTTTCTGG - Intronic
918315499 1:183319333-183319355 TCTTTTTATAAGTCATTCTCTGG - Intronic
918509746 1:185298316-185298338 CCTTATTACACTTTAATCTCTGG - Intronic
918838172 1:189497579-189497601 ACTTATTAGAAATTATTCTAGGG - Intergenic
918897318 1:190364737-190364759 CATTATTAAAATTTATTTTATGG - Intronic
919090643 1:192975036-192975058 CCATTTCAAATGTTATTCTCAGG + Intergenic
919447912 1:197732609-197732631 CCATATGCATAGTTATTCTCAGG + Intronic
919515295 1:198514830-198514852 CCTTATTAAAAGTTGAATTCTGG + Intergenic
920681196 1:208074177-208074199 CCTTAAGAAATGTTTTTCTCTGG + Intronic
921329563 1:214021988-214022010 CTTTATTTGATGTTATTCTCAGG + Intronic
921434828 1:215106412-215106434 CCCTATTAAAAGTTATGCAAAGG - Intronic
921464795 1:215474739-215474761 TCTAATTAATAGTTATACTCTGG + Intergenic
921965762 1:221087116-221087138 CCTTATTGAAATTTATTCTGTGG + Intergenic
922311102 1:224391811-224391833 CCTTTTCACAAGTTATTTTCTGG - Intronic
923306240 1:232691368-232691390 TCTTACTAAAAGTTATTTTTGGG - Intergenic
923944458 1:238867240-238867262 CCTTATCAAAAGTTGTTCAGTGG + Intergenic
924310552 1:242738357-242738379 CATTATTAAAATATATTTTCTGG + Intergenic
924555297 1:245113292-245113314 CATTCTTAAAAGCTTTTCTCAGG - Intronic
924591923 1:245412304-245412326 TGTTATTAAATGTTATTTTCTGG + Intronic
1065076790 10:22088628-22088650 ACTTTTTAAAAGTTGTTCTAAGG + Intergenic
1066524226 10:36258674-36258696 CCAAATGAAAAGTTATTCTCCGG + Intergenic
1069767368 10:70873048-70873070 CCTTATTTAAAATATTTCTCTGG - Intronic
1070904254 10:80057746-80057768 CCTTATTCAGTGTTAATCTCTGG - Intergenic
1073278848 10:102336771-102336793 CCTCATTATAAATTATTTTCAGG + Intronic
1073825994 10:107322173-107322195 CTTTATTGAAGGTTATTCCCAGG + Intergenic
1074031598 10:109694516-109694538 TCATATTAAAAGTTATGGTCAGG + Intergenic
1074479680 10:113807728-113807750 CCTTATTAAAACTTTGTTTCAGG + Intergenic
1074716817 10:116227337-116227359 CCTTTTTCAAACTTATTCTTTGG + Intronic
1075508247 10:123045855-123045877 CCTAATTAAAAGTTAAGATCAGG + Intronic
1077781503 11:5335038-5335060 CATGATTAAAAGTCAGTCTCTGG + Intronic
1078313803 11:10274006-10274028 CTGACTTAAAAGTTATTCTCTGG + Intronic
1079939941 11:26667722-26667744 CCTTTAGAAAAGTTACTCTCTGG + Exonic
1080224743 11:29948190-29948212 CCTTATTAATAGTTTCTTTCTGG - Intergenic
1081290343 11:41317406-41317428 CATTTTTAAAAGTTATCCTTAGG - Intronic
1084439200 11:69161562-69161584 CCTTATTAAAACATTTTCTTAGG - Intergenic
1084538370 11:69772071-69772093 CCTTACTAAAAGTAAATCACAGG + Exonic
1085538849 11:77247082-77247104 CCTTTTTAAACATTTTTCTCAGG + Intronic
1086775860 11:90832059-90832081 CCATTTTAAAATTTATCCTCAGG + Intergenic
1086776055 11:90834071-90834093 CCATTTTAAAATTTATCCTCAGG - Intergenic
1086993169 11:93328498-93328520 CCTTATTATTAGATATTTTCAGG - Intergenic
1087770110 11:102199763-102199785 TTTTATTAACAGTTCTTCTCAGG - Intronic
1088129874 11:106474675-106474697 CCTTTGTAAATTTTATTCTCAGG - Intergenic
1089909142 11:122078219-122078241 CCTTAGTAACATTTAGTCTCTGG - Intergenic
1090366356 11:126209882-126209904 GCTTATTAGAAGTGAATCTCAGG + Intronic
1091101381 11:132876951-132876973 CCTTATTTAAAATTACTCCCTGG - Intronic
1092313502 12:7383990-7384012 CATTATTTAAAATTATTTTCAGG - Intronic
1094119459 12:26954574-26954596 CATTAGTAAAAGGTATTATCTGG - Intronic
1094631854 12:32183563-32183585 CCTTTTTAAAAGCTATTAGCAGG - Intronic
1095268035 12:40182690-40182712 CCTTTTTATAAGGTGTTCTCTGG + Intergenic
1095449637 12:42316482-42316504 CCTTATACAAAATTATTCTATGG + Intronic
1095700161 12:45183282-45183304 GCTTATTAAAATTTAATTTCTGG - Intergenic
1099920058 12:88946492-88946514 GCTTATTAGAAGTTGCTCTCAGG - Intergenic
1100097143 12:91054643-91054665 CCTTATGAAAAGCTCTTTTCAGG + Intronic
1100419244 12:94414785-94414807 CCACATTAAAAATTATTCTGTGG + Intronic
1100774383 12:97958289-97958311 TCTTATTAAAAGTCATGCTCAGG + Intergenic
1101695864 12:107125852-107125874 GCATATTACATGTTATTCTCTGG + Intergenic
1104834923 12:131783305-131783327 ACTTATTAAAATTTAATTTCAGG - Intronic
1106065731 13:26346803-26346825 ACATATTAAAGATTATTCTCTGG - Intronic
1107072702 13:36288312-36288334 CATTATTTAAAGTTATTTCCGGG - Intronic
1107887117 13:44882836-44882858 ACTTCTTAACACTTATTCTCAGG - Intergenic
1108352175 13:49597723-49597745 TCTTTTTAAAAGTTTTTCTGTGG + Intergenic
1109900027 13:68756174-68756196 CCTTATTGAAAGTTAGTCCCTGG + Intergenic
1112875375 13:104031862-104031884 CATTATTAAAAATAAGTCTCTGG + Intergenic
1114732659 14:25010288-25010310 CGTTAATAAAACTTCTTCTCCGG + Intronic
1115140022 14:30160153-30160175 CCTTAGTAAAAGTTGCTCTGGGG + Intronic
1115954125 14:38758690-38758712 CCTTATCATAAGGTCTTCTCTGG - Intergenic
1116875944 14:50112085-50112107 CCTTATTAAAAATTGTTTACAGG - Intronic
1118319353 14:64743938-64743960 CCTTGTAAATAGTTGTTCTCTGG + Exonic
1120142948 14:80948807-80948829 CCATTTTAAAAGTTATGCTAAGG + Intronic
1120174830 14:81281953-81281975 TATTTTTAAAACTTATTCTCTGG + Intronic
1120572401 14:86137453-86137475 CCTTATTTAAATTTATTCCTAGG - Intergenic
1124845666 15:33287617-33287639 CTTTTTTAAAAGTTCTACTCTGG + Intergenic
1126528334 15:49683709-49683731 CCTTATTAAAACTCATCCTTTGG + Intergenic
1126773995 15:52084193-52084215 CCTTATTAAAAATGAATCTTGGG + Intergenic
1127443023 15:59030623-59030645 TCTTATAAAACGTTTTTCTCTGG - Intronic
1133507922 16:6430444-6430466 CCTTCTTCAAAGCTCTTCTCTGG - Intronic
1133916650 16:10115016-10115038 ACTTGTTTAAAATTATTCTCTGG + Intronic
1140282862 16:73570885-73570907 CTTTATTAAAAGCTCTTGTCAGG - Intergenic
1141229434 16:82151103-82151125 TATTATGAAAAGTTATTTTCTGG - Intronic
1141702658 16:85649673-85649695 CCTAATTAAGAGCGATTCTCAGG + Intronic
1144175531 17:12701940-12701962 ATTTATTAAAACTTATTCTATGG + Intronic
1146069291 17:29665064-29665086 CCTTCATAAAAATTAGTCTCAGG + Intronic
1146176544 17:30669031-30669053 CCTAATTTAAAGATATTTTCAGG - Intergenic
1146350006 17:32085145-32085167 CCTAATTTAAAGATATTTTCAGG - Intergenic
1147071583 17:37962505-37962527 CCATTTTAAAAATGATTCTCTGG - Intergenic
1147542231 17:41369945-41369967 CCTCATTAAATGTTTTACTCTGG + Intronic
1147941016 17:44047885-44047907 CCTTATTAAGAGTTCTTGGCTGG + Intronic
1148172527 17:45534646-45534668 TCTTCTTCAAGGTTATTCTCAGG - Intergenic
1148276743 17:46310804-46310826 TCTTCTTCAAGGTTATTCTCAGG + Intronic
1148298860 17:46528392-46528414 TCTTCTTCAAGGTTATTCTCAGG + Intronic
1148363393 17:47032889-47032911 TCTTCTTCAAGGTTATTCTCAGG + Intronic
1150033040 17:61761209-61761231 ATTTAGTAAAAGTTTTTCTCAGG - Intronic
1150403731 17:64881571-64881593 TCTTCTTCAAGGTTATTCTCAGG - Intronic
1150700804 17:67445291-67445313 ACAGAATAAAAGTTATTCTCTGG - Intronic
1151737076 17:75949872-75949894 CCTGATGAAAAGTTATGATCAGG - Exonic
1153289628 18:3488163-3488185 CATTTTAAAAAGTTAGTCTCTGG - Intergenic
1156630016 18:38955881-38955903 CCTTATTGAGATTTATCCTCTGG + Intergenic
1159125703 18:64221862-64221884 ATTTATTAAAAGTTATTTTATGG + Intergenic
1159356436 18:67342602-67342624 CGTATTTAAAAGTTATTGTCTGG + Intergenic
1162664906 19:12202229-12202251 CCTTTTTAAAAATAATTCTTTGG + Intergenic
1162982279 19:14247857-14247879 CCTAATTTAAAGGTATTTTCAGG + Intergenic
1163901221 19:20101720-20101742 CCTTATCAAATGACATTCTCTGG - Intronic
926041965 2:9680658-9680680 CCTGATTAACACTTATTCTTAGG + Intergenic
926270526 2:11362240-11362262 CATTGTTAAAAGTCATTCTATGG + Intergenic
926845437 2:17132234-17132256 ACTTTTTGAAACTTATTCTCCGG - Intergenic
929987971 2:46756165-46756187 ACTTTTTAAAAGTTATTTTTTGG + Intronic
932901710 2:75708807-75708829 CCTTCTTAAAAGTTAGTTGCGGG - Intronic
932989634 2:76771122-76771144 CCTTGTAAAAAGTTTTTTTCAGG - Intronic
936166375 2:110123590-110123612 CCTTATAAAAATTTATTTTATGG + Exonic
936609732 2:113990273-113990295 CCATTTTAAAAATTATTCTATGG - Intergenic
938581019 2:132646519-132646541 CTTTATTAACAGGTATTCACAGG - Exonic
939675173 2:145063209-145063231 GATTGTTAAAAGTTATACTCTGG + Intergenic
940470010 2:154084712-154084734 CTTTATATAAAGTTATTCTTAGG - Intronic
941148317 2:161881861-161881883 CATTATAAAAAATTATTGTCAGG - Intronic
941258626 2:163267779-163267801 TCTTTTTAAAAGTTATTTTGAGG + Intergenic
941266624 2:163370930-163370952 TCTTTTTAGAATTTATTCTCTGG - Intergenic
943910450 2:193559829-193559851 CTTTATTAAAACTTCTTCTGGGG + Intergenic
944234931 2:197433810-197433832 CCTTGTTACAAGATGTTCTCAGG + Intronic
944754628 2:202747732-202747754 CCTTGGTTAAATTTATTCTCAGG - Intronic
945213332 2:207407055-207407077 CCTTATTAAAAGAGAATATCAGG - Intergenic
945405628 2:209444798-209444820 CTTGATTAAAAGTTCTTATCGGG + Intronic
945824483 2:214704066-214704088 CCTTAGTAAAATTTATTCCTAGG - Intergenic
947204836 2:227650917-227650939 ACTTATTTAAAGTTGTTCTCTGG + Intergenic
1169690985 20:8331796-8331818 CCTTACTAACAGGTATTCTGTGG + Intronic
1169842868 20:9959505-9959527 CAAAATTAAAAGTTTTTCTCTGG - Intergenic
1169904078 20:10582817-10582839 CCTTATAAAATGTTATTTTCAGG + Intronic
1169964177 20:11196696-11196718 CCTGATTAAAAGGTAGTCCCAGG + Intergenic
1170208273 20:13822835-13822857 CCTTCTTAAATCTTATCCTCAGG - Intergenic
1172036903 20:32017657-32017679 GCTCAGTAAAAGTTATTATCAGG + Intronic
1172330224 20:34070544-34070566 ATTTATTAAAAATAATTCTCAGG + Intronic
1173080712 20:39864489-39864511 CCTCCTTAAAAGTTATCCTTAGG - Intergenic
1173616734 20:44408038-44408060 CCTTAATAAATGTTGTGCTCTGG - Intronic
1174930394 20:54807353-54807375 CTTTTTTAAAAGTTTTTCTCTGG - Intergenic
1177710594 21:24768724-24768746 ACGTAATAAAAGTTCTTCTCTGG + Intergenic
1178039062 21:28619326-28619348 CCTTATGAGAAGTTATTTTCTGG + Intergenic
1179244243 21:39616836-39616858 TTTTATTAAAAGTTGCTCTCAGG + Intronic
1181138394 22:20785869-20785891 ACTTATTAAAATTTATATTCCGG - Intronic
1185124772 22:49003210-49003232 CTTTATTTAAAGCTTTTCTCTGG + Intergenic
1185196238 22:49471595-49471617 CCTTATTAAAAATCATTTCCTGG + Intronic
949388441 3:3532065-3532087 CATTATAAAAAATTATTTTCAGG + Intergenic
949403634 3:3692134-3692156 ACTTATTAGAACTTGTTCTCTGG + Intergenic
949532016 3:4965730-4965752 CCTTATTAAAAGTAAGTAACAGG + Intergenic
950787418 3:15448205-15448227 CCTTATTGAAAGTCTTTTTCAGG + Intronic
951471648 3:23062822-23062844 CCTTCTTAAATGTTGTGCTCTGG + Intergenic
952016809 3:28966782-28966804 CCTGTGTAAAATTTATTCTCAGG + Intergenic
953220300 3:40964447-40964469 CCTTGGCTAAAGTTATTCTCAGG + Intergenic
954141002 3:48605427-48605449 GCTTATGAAATGTTCTTCTCTGG - Intronic
955037734 3:55285185-55285207 CCTTATTGAAGTTTATTCTGAGG - Intergenic
957326481 3:78701690-78701712 CCTTTTAAAAAGTTATTTTGTGG - Intronic
959691164 3:109199852-109199874 CTATCTTAAAAGTTGTTCTCCGG + Intergenic
960921303 3:122749282-122749304 CTATGTTAAAAGTTATACTCAGG - Intronic
963136874 3:141913932-141913954 CCTTATTAAAAGTTATCATTTGG + Intronic
963317773 3:143778742-143778764 CCTTACAAAAAGTTATTCATTGG + Intronic
963514905 3:146296709-146296731 CATTTTTAAAAATTATTCTAGGG + Intergenic
965284371 3:166799195-166799217 TCTTATTGAAATTTGTTCTCAGG + Intergenic
966025724 3:175278598-175278620 CCTTATAAAAAGTTCTTTTCTGG + Intronic
966449824 3:180045687-180045709 TCTAATGAAAAGTTATTTTCAGG + Intergenic
968968204 4:3780258-3780280 CCCAGTTAAAATTTATTCTCAGG + Intergenic
970077127 4:12235612-12235634 CCTTGTTTAAATTTATTCTTAGG + Intergenic
971439956 4:26673623-26673645 ACCTTTTAAAATTTATTCTCTGG - Intronic
971632592 4:29013000-29013022 CCGTATTAAAAGTTACTTTGTGG + Intergenic
971703069 4:30005988-30006010 CCTTAGTAAAATTTATTCATGGG + Intergenic
971841689 4:31861243-31861265 CATTTTTAAAAGTTATTTTTGGG + Intergenic
973839779 4:54849600-54849622 CGTTTTTAAAAGGTATTTTCTGG - Intergenic
974070423 4:57118507-57118529 ACTGAATAAAAGCTATTCTCAGG + Intergenic
974300821 4:60065131-60065153 TCTAATTAAATGTTATTCTTAGG + Intergenic
975011046 4:69352591-69352613 CCTTTTTAAAATTTTTTCTGTGG + Intronic
976910643 4:90301129-90301151 ACATTTTAAAAATTATTCTCTGG - Intronic
977576462 4:98679775-98679797 CGTTATTAGAAATTATTTTCTGG - Intergenic
977959962 4:103074563-103074585 CTTTATAAAATGTTATTTTCTGG - Intronic
978133176 4:105224736-105224758 GCTTATGAAAATTTATTCTGGGG + Intronic
978684179 4:111418977-111418999 CCTTCTTAAAAATTATTTTGAGG - Intergenic
979453640 4:120902095-120902117 CCATTTCAAAAGTGATTCTCTGG - Intronic
979861862 4:125703949-125703971 CATTATTGCATGTTATTCTCTGG - Intergenic
980341391 4:131552293-131552315 ACTTATTAAAAATTTTTCTGTGG + Intergenic
981112840 4:140955922-140955944 TATTAGGAAAAGTTATTCTCAGG + Intronic
984308242 4:178022040-178022062 CATTATTAAGATTTCTTCTCTGG - Intergenic
985308252 4:188567862-188567884 CCTTATGATAAGTTAGTTTCAGG + Intergenic
987810538 5:22829102-22829124 TATTATTAGAAGTTATTCTATGG - Intronic
988028025 5:25725712-25725734 CATTAATAAAATTTATTTTCAGG - Intergenic
988274785 5:29067196-29067218 GCTCATTAAAAATTAGTCTCAGG + Intergenic
988443196 5:31255686-31255708 TCTTATTAATAGTTAGTCTCAGG + Intronic
989165071 5:38425719-38425741 GCTTTTTAAAAGTTATTCAAGGG - Intronic
989790462 5:45393113-45393135 ACATATTTAAAGTTATTCTTTGG + Intronic
989836174 5:45995267-45995289 GCTTCTTTATAGTTATTCTCTGG - Intergenic
990527892 5:56646168-56646190 CCTCATAACAAGTTATTCTGAGG + Intergenic
990787184 5:59434779-59434801 CCTGATTAGCAGTTATTGTCTGG - Intronic
990978691 5:61582036-61582058 CCTTATTAATATTTATTTTATGG - Intergenic
991513571 5:67408189-67408211 CATTATTAAATGTTATTCCCTGG + Intergenic
991917430 5:71619083-71619105 ACATATTTAAAATTATTCTCAGG + Intronic
992665032 5:78999726-78999748 CATTAGTAAAAGTTTATCTCTGG + Intronic
992930850 5:81643360-81643382 TGGTATTAAAAGTTATTCTTTGG - Intronic
993395915 5:87388334-87388356 CCTTGTTAAATGTTATTCCAAGG + Intronic
996150671 5:120030554-120030576 CCTTACTAGGATTTATTCTCGGG + Intergenic
996483766 5:124006130-124006152 CACTATTAATAATTATTCTCAGG - Intergenic
998324420 5:141266916-141266938 GCTTATTGAAGGTAATTCTCTGG + Intergenic
998492754 5:142561279-142561301 TCTCATTGAAAGTTATTCTTGGG + Intergenic
999345118 5:150811309-150811331 GCTTATTGAAAGTGATTCACAGG - Intergenic
1000310338 5:160037413-160037435 CCTTATTAAAAGTTAGATTTGGG + Intronic
1000420171 5:161029518-161029540 TCTTTTTAAATTTTATTCTCAGG - Intergenic
1003887127 6:10531964-10531986 CCTAATTAAAAGATTTGCTCAGG + Intronic
1005023276 6:21437990-21438012 GCTCATTAAAAATTATTCTGCGG + Intergenic
1005347349 6:24903716-24903738 CCACATTAGAAGTTACTCTCTGG - Intronic
1006709354 6:36052349-36052371 CCATTTTAAAACTTATTTTCTGG + Intronic
1007081180 6:39105657-39105679 CCTTCTTGAAGGTTCTTCTCTGG - Exonic
1007087034 6:39155772-39155794 TCTAAATAAAGGTTATTCTCTGG - Intergenic
1009783553 6:68300900-68300922 CCTTATTACTAGTTTTTATCAGG + Intergenic
1009841276 6:69077926-69077948 CATTATTAAAAGTGTTTTTCTGG + Intronic
1010390386 6:75330274-75330296 CTTTATAAAAAATGATTCTCTGG - Intronic
1010458311 6:76083774-76083796 CCTTATGAATACTTAGTCTCAGG - Intergenic
1010606566 6:77896493-77896515 CTTTATTTAAACATATTCTCTGG - Intronic
1011850586 6:91623287-91623309 CCTTATTAAAATGTATATTCTGG - Intergenic
1012599437 6:101076563-101076585 CATTATTAAAAATTGCTCTCAGG - Intergenic
1012789053 6:103669129-103669151 CCTTATTGAAAATTAATGTCTGG + Intergenic
1013547189 6:111169739-111169761 CCTTCTTAAAATTTATTCAGTGG - Intronic
1013863682 6:114667324-114667346 CCTTTTTATAATTTATTCTAAGG + Intergenic
1014059700 6:117057037-117057059 CCTTAGTTAAATTTATTCTTAGG + Intergenic
1014293156 6:119584615-119584637 CCTTACTAAAAGTTAATCCATGG + Intergenic
1014650536 6:124030993-124031015 GCTTTTTAAAAGTCATTTTCAGG + Intronic
1015448162 6:133332308-133332330 CCTTAATTAAAGTTCTTCTTTGG + Intronic
1015561992 6:134525826-134525848 CCTTGTTAAATGTTATTCCCTGG - Intergenic
1017684826 6:156901602-156901624 CTTTATTAAAAATTATGTTCTGG + Intronic
1018158475 6:161013366-161013388 CCATATTAAAAGTTAAACTGAGG - Intronic
1020887175 7:13832656-13832678 CCTAATTTAAAGTTATACTGTGG + Intergenic
1020946739 7:14619265-14619287 AGTTATAAAAAGTTATTATCTGG + Intronic
1021605801 7:22408228-22408250 CCTTGGTTAAATTTATTCTCAGG - Intergenic
1023540764 7:41263147-41263169 GCTTAATAAAAGCTATTCACAGG + Intergenic
1027364397 7:77442384-77442406 CCTTATTAGTTGTTATTTTCAGG - Intergenic
1027483640 7:78731383-78731405 GCCTATTCAAAATTATTCTCAGG - Intronic
1027696373 7:81416054-81416076 CCTTTTCAAAAGTTATTTTTTGG - Intergenic
1028938430 7:96491724-96491746 TCTTCTTTGAAGTTATTCTCTGG + Intronic
1030906779 7:115194891-115194913 CCTTATTAATTTTTATTCTTTGG - Intergenic
1032424416 7:131810182-131810204 ACTTGTTAAATGTTATTTTCTGG + Intergenic
1035491562 7:159284067-159284089 CCTTATTAAAAATTTTTTTGGGG - Intergenic
1035970025 8:4237811-4237833 CCTTTTTAAAAATTATTTTTGGG - Intronic
1038528438 8:28296971-28296993 CCATTTAAAACGTTATTCTCTGG + Intergenic
1038810329 8:30834971-30834993 ACTTTTTAAAAGAAATTCTCTGG + Intronic
1040927362 8:52698610-52698632 CCTTATTAAAAGTTATTCTCTGG - Intronic
1042126957 8:65547863-65547885 GCTTATTAAAAGTTACTCTCTGG + Intergenic
1043110755 8:76177963-76177985 CCTTAAAGAAATTTATTCTCAGG + Intergenic
1043163273 8:76872294-76872316 ACTTATTTAAAATTATTCGCTGG + Intergenic
1043316545 8:78929345-78929367 CCTTAATAAAAATTACTATCAGG + Intergenic
1044013810 8:87026421-87026443 GCTTATTAAAAGTTACTTTGAGG + Intronic
1044468153 8:92531975-92531997 CCTTAGTTAAATTTATTCTTAGG - Intergenic
1046498115 8:115040527-115040549 CCTTGGTTAAATTTATTCTCAGG + Intergenic
1047055545 8:121160554-121160576 CTTTATTAAAAATGAGTCTCTGG - Intergenic
1048376910 8:133830832-133830854 CCTTATTAATAGTTGTTCACAGG + Intergenic
1048570173 8:135646262-135646284 ACTCATTAAAAGTTATCTTCAGG + Intronic
1050258168 9:3815094-3815116 CCTTATTAAAAGTAAATTGCTGG + Intergenic
1051167424 9:14279122-14279144 CGTTATCAAAATTTATCCTCAGG + Intronic
1051783720 9:20719396-20719418 TTTTATTAATAGTTATTCTTTGG + Intronic
1052682001 9:31705388-31705410 CGTTAATAATAGTTACTCTCAGG - Intergenic
1055725565 9:79224584-79224606 CCTTATTAAAAATTTTTCAAAGG - Intergenic
1059233755 9:112744945-112744967 TCTTATTAACAGTGATTCTTTGG - Intergenic
1059520332 9:114934685-114934707 GCATAATAAAAGTTATTGTCTGG + Intergenic
1187589452 X:20700412-20700434 CCTTTTTAAAAGTGTTTTTCTGG + Intergenic
1188362830 X:29277516-29277538 CCTTATGAAGACTTTTTCTCAGG + Intronic
1189813885 X:44805525-44805547 CCTTATTTAAATTTATTGTCAGG - Intergenic
1190648681 X:52547141-52547163 ACTTAATCAAAGTTATTCTTAGG - Intergenic
1192899358 X:75479079-75479101 TCTTATTAACATGTATTCTCTGG + Intronic
1193020682 X:76789543-76789565 CCTTAGTAAAATTTATTCCTAGG - Intergenic
1194119401 X:89942464-89942486 CCTTATTAAATGTTATTCCATGG - Intergenic
1194213669 X:91100632-91100654 CTTTAAAAAAAGTTATTCTTAGG + Intergenic
1194573573 X:95583011-95583033 TCTTTTTAAAAGTTATTTCCAGG + Intergenic
1195857116 X:109343471-109343493 GCTTAGTAACAGTTATTCTTAGG - Intergenic
1197257571 X:124280246-124280268 CTTTATTAAAAATGTTTCTCAGG + Intronic
1198257977 X:134941695-134941717 CCTTTTAAAAAGTTATTGGCTGG + Intergenic
1198685923 X:139228042-139228064 ACTTATTGAAACTTTTTCTCAGG + Intergenic
1200472273 Y:3600021-3600043 CTTTATTAAATGTTATTCCATGG - Intergenic
1201926215 Y:19290767-19290789 CTTTTTTAGGAGTTATTCTCTGG + Intergenic