ID: 1040936444

View in Genome Browser
Species Human (GRCh38)
Location 8:52786891-52786913
Sequence AGGAGGATCTTGAACCCAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040936444_1040936452 28 Left 1040936444 8:52786891-52786913 CCTTCTGGGTTCAAGATCCTCCT No data
Right 1040936452 8:52786942-52786964 CAAGCGCACGCCACTGTGCCTGG No data
1040936444_1040936447 0 Left 1040936444 8:52786891-52786913 CCTTCTGGGTTCAAGATCCTCCT No data
Right 1040936447 8:52786914-52786936 GCCTCAGCCTCCTGAATAGCTGG 0: 3459
1: 93532
2: 199322
3: 235334
4: 229635
1040936444_1040936449 1 Left 1040936444 8:52786891-52786913 CCTTCTGGGTTCAAGATCCTCCT No data
Right 1040936449 8:52786915-52786937 CCTCAGCCTCCTGAATAGCTGGG 0: 4324
1: 106582
2: 211547
3: 247830
4: 263605

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040936444 Original CRISPR AGGAGGATCTTGAACCCAGA AGG (reversed) Intergenic
No off target data available for this crispr