ID: 1040936911

View in Genome Browser
Species Human (GRCh38)
Location 8:52791003-52791025
Sequence GTTTTTAAGGAAATCATGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040936900_1040936911 7 Left 1040936900 8:52790973-52790995 CCCGAAATCCATCAGAAGTTCTG No data
Right 1040936911 8:52791003-52791025 GTTTTTAAGGAAATCATGGAGGG No data
1040936906_1040936911 -1 Left 1040936906 8:52790981-52791003 CCATCAGAAGTTCTGGGCTGGGG No data
Right 1040936911 8:52791003-52791025 GTTTTTAAGGAAATCATGGAGGG No data
1040936899_1040936911 8 Left 1040936899 8:52790972-52790994 CCCCGAAATCCATCAGAAGTTCT No data
Right 1040936911 8:52791003-52791025 GTTTTTAAGGAAATCATGGAGGG No data
1040936901_1040936911 6 Left 1040936901 8:52790974-52790996 CCGAAATCCATCAGAAGTTCTGG No data
Right 1040936911 8:52791003-52791025 GTTTTTAAGGAAATCATGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040936911 Original CRISPR GTTTTTAAGGAAATCATGGA GGG Intergenic
No off target data available for this crispr