ID: 1040945442

View in Genome Browser
Species Human (GRCh38)
Location 8:52880358-52880380
Sequence AATTTTAAGGGGATTGTAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040945429_1040945442 14 Left 1040945429 8:52880321-52880343 CCTTCAAATCCATCTCCCTGAGG No data
Right 1040945442 8:52880358-52880380 AATTTTAAGGGGATTGTAGTGGG No data
1040945432_1040945442 5 Left 1040945432 8:52880330-52880352 CCATCTCCCTGAGGAGTTCTGGG 0: 6
1: 18
2: 42
3: 87
4: 388
Right 1040945442 8:52880358-52880380 AATTTTAAGGGGATTGTAGTGGG No data
1040945436_1040945442 -1 Left 1040945436 8:52880336-52880358 CCCTGAGGAGTTCTGGGCTGGGA No data
Right 1040945442 8:52880358-52880380 AATTTTAAGGGGATTGTAGTGGG No data
1040945437_1040945442 -2 Left 1040945437 8:52880337-52880359 CCTGAGGAGTTCTGGGCTGGGAA No data
Right 1040945442 8:52880358-52880380 AATTTTAAGGGGATTGTAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040945442 Original CRISPR AATTTTAAGGGGATTGTAGT GGG Intergenic
No off target data available for this crispr