ID: 1040945610

View in Genome Browser
Species Human (GRCh38)
Location 8:52881725-52881747
Sequence AACAGGGAAATGCCCACAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040945603_1040945610 1 Left 1040945603 8:52881701-52881723 CCCAGTGATGAGAGGGAACCAAG No data
Right 1040945610 8:52881725-52881747 AACAGGGAAATGCCCACAAGGGG No data
1040945604_1040945610 0 Left 1040945604 8:52881702-52881724 CCAGTGATGAGAGGGAACCAAGC No data
Right 1040945610 8:52881725-52881747 AACAGGGAAATGCCCACAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040945610 Original CRISPR AACAGGGAAATGCCCACAAG GGG Intergenic
No off target data available for this crispr