ID: 1040947133

View in Genome Browser
Species Human (GRCh38)
Location 8:52895276-52895298
Sequence TACTCACAGCCGCCCCGGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040947133_1040947142 30 Left 1040947133 8:52895276-52895298 CCACTCCGGGGCGGCTGTGAGTA No data
Right 1040947142 8:52895329-52895351 CCTGGAAGTCTTCGCCATCCAGG No data
1040947133_1040947139 12 Left 1040947133 8:52895276-52895298 CCACTCCGGGGCGGCTGTGAGTA No data
Right 1040947139 8:52895311-52895333 TAATTTTCCACAGCATCTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040947133 Original CRISPR TACTCACAGCCGCCCCGGAG TGG (reversed) Intergenic
No off target data available for this crispr