ID: 1040948833

View in Genome Browser
Species Human (GRCh38)
Location 8:52915308-52915330
Sequence CAGTTGGCCAAGAATGATGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040948830_1040948833 -5 Left 1040948830 8:52915290-52915312 CCAACCTCACAAGTGACTCAGTT No data
Right 1040948833 8:52915308-52915330 CAGTTGGCCAAGAATGATGATGG No data
1040948832_1040948833 -9 Left 1040948832 8:52915294-52915316 CCTCACAAGTGACTCAGTTGGCC No data
Right 1040948833 8:52915308-52915330 CAGTTGGCCAAGAATGATGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040948833 Original CRISPR CAGTTGGCCAAGAATGATGA TGG Intergenic
No off target data available for this crispr