ID: 1040948833 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 8:52915308-52915330 |
| Sequence | CAGTTGGCCAAGAATGATGA TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1040948830_1040948833 | -5 | Left | 1040948830 | 8:52915290-52915312 | CCAACCTCACAAGTGACTCAGTT | No data | ||
| Right | 1040948833 | 8:52915308-52915330 | CAGTTGGCCAAGAATGATGATGG | No data | ||||
| 1040948832_1040948833 | -9 | Left | 1040948832 | 8:52915294-52915316 | CCTCACAAGTGACTCAGTTGGCC | No data | ||
| Right | 1040948833 | 8:52915308-52915330 | CAGTTGGCCAAGAATGATGATGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1040948833 | Original CRISPR | CAGTTGGCCAAGAATGATGA TGG | Intergenic | ||
| No off target data available for this crispr | |||||