ID: 1040951095

View in Genome Browser
Species Human (GRCh38)
Location 8:52939761-52939783
Sequence TTCTCTGGTTTTTCCGGAGG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 201
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 188}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040951095_1040951104 29 Left 1040951095 8:52939761-52939783 CCTCCTCCGGAAAAACCAGAGAA 0: 1
1: 0
2: 0
3: 12
4: 188
Right 1040951104 8:52939813-52939835 GAGCAGGTCCGTGCAGAACCGGG 0: 1
1: 0
2: 0
3: 10
4: 121
1040951095_1040951103 28 Left 1040951095 8:52939761-52939783 CCTCCTCCGGAAAAACCAGAGAA 0: 1
1: 0
2: 0
3: 12
4: 188
Right 1040951103 8:52939812-52939834 CGAGCAGGTCCGTGCAGAACCGG 0: 1
1: 0
2: 0
3: 7
4: 69
1040951095_1040951101 13 Left 1040951095 8:52939761-52939783 CCTCCTCCGGAAAAACCAGAGAA 0: 1
1: 0
2: 0
3: 12
4: 188
Right 1040951101 8:52939797-52939819 TGAAACGAGCGTCCGCGAGCAGG 0: 1
1: 0
2: 0
3: 2
4: 10

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040951095 Original CRISPR TTCTCTGGTTTTTCCGGAGG AGG (reversed) Exonic