ID: 1040951095

View in Genome Browser
Species Human (GRCh38)
Location 8:52939761-52939783
Sequence TTCTCTGGTTTTTCCGGAGG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 201
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 188}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040951095_1040951103 28 Left 1040951095 8:52939761-52939783 CCTCCTCCGGAAAAACCAGAGAA 0: 1
1: 0
2: 0
3: 12
4: 188
Right 1040951103 8:52939812-52939834 CGAGCAGGTCCGTGCAGAACCGG 0: 1
1: 0
2: 0
3: 7
4: 69
1040951095_1040951101 13 Left 1040951095 8:52939761-52939783 CCTCCTCCGGAAAAACCAGAGAA 0: 1
1: 0
2: 0
3: 12
4: 188
Right 1040951101 8:52939797-52939819 TGAAACGAGCGTCCGCGAGCAGG 0: 1
1: 0
2: 0
3: 2
4: 10
1040951095_1040951104 29 Left 1040951095 8:52939761-52939783 CCTCCTCCGGAAAAACCAGAGAA 0: 1
1: 0
2: 0
3: 12
4: 188
Right 1040951104 8:52939813-52939835 GAGCAGGTCCGTGCAGAACCGGG 0: 1
1: 0
2: 0
3: 10
4: 121

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040951095 Original CRISPR TTCTCTGGTTTTTCCGGAGG AGG (reversed) Exonic
900669266 1:3840239-3840261 TTCTTTTCTTTTTTCGGAGGCGG + Intronic
901381256 1:8876219-8876241 TTCTCTGGAATGTCCTGAGGTGG + Intronic
901713589 1:11135260-11135282 TTTTCTGGTTTTTCTAGAGGGGG + Intronic
902477858 1:16697616-16697638 TTTTCTGGCTTAGCCGGAGGAGG + Intergenic
904030177 1:27528604-27528626 GTCTCTGGGTTTTCCCCAGGAGG + Intergenic
904663725 1:32104062-32104084 TTCTCTGGGCTTTTTGGAGGAGG + Intergenic
905688534 1:39926235-39926257 GTCTCTGGTTTTCCCTGGGGTGG + Intergenic
909196629 1:72634916-72634938 TTCTCTGGTTAGTCCTAAGGTGG - Intergenic
910546750 1:88426557-88426579 TTCTCTGGGTTATCAGGAAGAGG - Intergenic
912544155 1:110438932-110438954 TTCTCTGGTTTGTCCTGAGTTGG + Intergenic
913495799 1:119427107-119427129 TTTTATGGATTTTCCTGAGGAGG + Intergenic
913528234 1:119713566-119713588 TTCTCTGGCTTTTCCAGAAGGGG - Intronic
916513671 1:165495990-165496012 TTCTATGTTTTCTCCCGAGGGGG - Intergenic
918098682 1:181355031-181355053 TTCTCTGGGTTTTCTGGCAGTGG - Intergenic
921001843 1:211052148-211052170 TTCTCTGCTTTTTCCCTAGGAGG - Intronic
922452986 1:225751553-225751575 TTGTCTCTTTTTTCAGGAGGAGG - Intergenic
923237836 1:232051613-232051635 GTGTCTGGGGTTTCCGGAGGAGG + Intergenic
924049064 1:240061969-240061991 TTCTCTGGTTGGTCCTGAGTTGG - Intronic
924232822 1:241976638-241976660 TTTTCTTGTTTTTCCAGAGAGGG + Intergenic
1063580445 10:7301611-7301633 GTCTCTGGTTTGTCCTGTGGAGG - Intronic
1063682626 10:8204262-8204284 TTGTCTTGTTTTTCCAGAGATGG - Intergenic
1066601132 10:37108231-37108253 TTTTCTGGTTGGTCCTGAGGTGG - Intergenic
1069706637 10:70462804-70462826 CTCTCTGGTTTTTTAGAAGGGGG + Intergenic
1075405819 10:122195158-122195180 TTACCTGGTTCTTCCGGGGGTGG - Exonic
1075986111 10:126786804-126786826 TTCCCTGGTTTTTTCTGGGGAGG - Intergenic
1077603838 11:3593595-3593617 TTCTCCTGTTTGTCCTGAGGAGG + Intergenic
1078161836 11:8846766-8846788 TTCTCTGTTTATACCAGAGGCGG + Intronic
1080384610 11:31803884-31803906 GTCTGTGGTTTTTGGGGAGGGGG - Intronic
1080973804 11:37310361-37310383 TTCTGTGTTTTTTGTGGAGGTGG + Intergenic
1083742435 11:64718002-64718024 TTCTCTTTTTTTTCCTGATGTGG + Intronic
1084229286 11:67739272-67739294 TTCTCCTGTTTGTCCTGAGGAGG + Intergenic
1085957606 11:81418800-81418822 GTCTCTGATTTCTTCGGAGGCGG + Intergenic
1086995358 11:93350041-93350063 TTCTCTAGTTTGTCCTGAGTTGG + Intronic
1093011203 12:14109221-14109243 TTTTCAGTTTTTTCAGGAGGGGG + Intergenic
1093716414 12:22387969-22387991 TCCTTTGGTTTTTTCTGAGGAGG - Intronic
1093942669 12:25071591-25071613 TTCTCTGCTTTTTACAAAGGAGG + Intronic
1098523801 12:71463208-71463230 TGCTCAGGTTTTTCTGGAGGTGG - Intronic
1103653576 12:122452968-122452990 TTCTCTGCCATTTGCGGAGGTGG + Intergenic
1104072184 12:125355421-125355443 TTCTCTGGTTGGCCCGGAGTTGG + Intronic
1104526158 12:129524766-129524788 TTCTCTGTTCTTCCGGGAGGCGG + Intronic
1106017513 13:25883740-25883762 TTCTCTGGTTTTACCTGCAGTGG - Intronic
1107215441 13:37912307-37912329 TTGTCTAGTTTTTTTGGAGGGGG - Intergenic
1108080605 13:46731241-46731263 TTCTCTTTTTTTTCTGGAGATGG + Intronic
1109195069 13:59369988-59370010 TTCTCTGCTTTTACCTGAGATGG + Intergenic
1112617547 13:101020691-101020713 TTCTCTGGTTTGTCCTGAATTGG + Intergenic
1114602182 14:23965915-23965937 CTCTCTTCTTTTTCCAGAGGCGG + Exonic
1114606352 14:24001016-24001038 CTCTCTTCTTTTTCCAGAGGCGG + Exonic
1117389231 14:55247361-55247383 TGGTCTGGTTTTTCCAGATGGGG - Intergenic
1118391792 14:65302075-65302097 TTCTCTGGTTGGTCCTGAGTTGG - Intergenic
1119274345 14:73340010-73340032 TTCTCTGGTTGGTCCAGAGTTGG + Intronic
1125727672 15:41876383-41876405 AGCTCAGGTTTTTCCTGAGGAGG - Intronic
1126830712 15:52601484-52601506 TTCTCTATTTTTTTGGGAGGTGG + Intronic
1127544992 15:59984878-59984900 TTTTCTGTGTTTTCCTGAGGGGG - Intergenic
1128171382 15:65517047-65517069 TTTTCTGGTTTTTCAGCTGGTGG - Exonic
1130774085 15:86959421-86959443 TTCTCTGGTTTGACCAGAAGTGG + Intronic
1131246645 15:90800039-90800061 TTCCCTGGTTTTTCCCAGGGAGG + Intronic
1132844610 16:1994181-1994203 ATCTCTGGTCTTTCAGGAGAGGG - Exonic
1133517028 16:6519373-6519395 TTCTCTGGGTTTTCCCAAGGTGG - Intronic
1134210775 16:12274705-12274727 TTTTGTGGTTTTTGCAGAGGTGG + Intronic
1134849611 16:17469996-17470018 CTCTCTGGTTTTTGCCGAGCTGG - Intronic
1135858174 16:26031267-26031289 TTCTCTGGTTCTTCCCGGGGCGG - Intronic
1137064262 16:35822584-35822606 TTCTCTAGTTTATACGGAGAAGG - Intergenic
1137352620 16:47726863-47726885 TTCACTGGTTTCTCAGGAGTGGG + Intergenic
1139872788 16:70120894-70120916 TTCTCTGGTTTTTAGAGAGTTGG + Intronic
1140209919 16:72961680-72961702 TTCCCCAGTTTTTCCCGAGGGGG - Intronic
1140362988 16:74360436-74360458 TTCTCTGGTTTTTAGAGAGTTGG - Intergenic
1143330950 17:6135335-6135357 TTCTCTGGCTATTCCTGGGGTGG + Intergenic
1143737563 17:8923815-8923837 CTTTCTGGTTTTTCTGGATGTGG + Intronic
1144540934 17:16142057-16142079 ATCTTTGGTTTTTGAGGAGGGGG - Intronic
1145214269 17:21040889-21040911 TTTTTTTTTTTTTCCGGAGGGGG + Intronic
1145961613 17:28889642-28889664 TTTTTTGGTTTTTCTGGAGATGG + Intronic
1148726331 17:49793442-49793464 TGCTCTGGTATTCCCTGAGGAGG + Intronic
1150321619 17:64218890-64218912 TTCCCTGGTTCTTTCAGAGGAGG - Intronic
1151235170 17:72714696-72714718 TTCTCTGGTCTTTACCAAGGAGG - Intronic
1151777379 17:76214812-76214834 TTCCTTGGTTTGTCCGGATGAGG - Intronic
1203161791 17_GL000205v2_random:59117-59139 TTCTGTGGTTTTTGTGGAGACGG - Intergenic
1153332555 18:3888903-3888925 TTATCTGGATTTTCAGGAGAGGG + Intronic
1157606557 18:48929690-48929712 TTCCCTGGTTTTGCAGGTGGTGG + Intronic
1159308334 18:66674993-66675015 TTCTCTGGTTGTTCCTAAGTAGG - Intergenic
1160424554 18:78771120-78771142 TTCCCTGGTGGTCCCGGAGGAGG + Intergenic
1162537069 19:11269060-11269082 TTTTCTGCTGTTTCCGGAGCCGG + Intergenic
1164486349 19:28658800-28658822 TTCTCTGGTTTTTTCTCATGTGG - Intergenic
1165300408 19:34964609-34964631 TTCTCTACTTTTTGCGGGGGGGG + Intergenic
1202711877 1_KI270714v1_random:23443-23465 TTTTCTGGCTTAGCCGGAGGAGG + Intergenic
925566999 2:5266758-5266780 TTTTCTGGTCTTGCCTGAGGTGG - Intergenic
926006464 2:9376892-9376914 TTGTTTGGTTTTTCAGGAGCCGG + Exonic
927436986 2:23075077-23075099 TTTTCTGCTTTTTCCTGAGCAGG - Intergenic
931056101 2:58473338-58473360 TTGCCAGGTTTTTCTGGAGGAGG + Intergenic
932090372 2:68800468-68800490 TTCTGTGGTTGTTCAGGATGGGG + Intronic
932176063 2:69603826-69603848 TTCTCTGGTGTTTCAGGAGTTGG + Intronic
933012868 2:77089254-77089276 TTCTCTGCTTTTCTGGGAGGGGG + Intronic
933898988 2:86835832-86835854 TTCTCTGGTCTGTCCGGGGCTGG + Intronic
935781558 2:106513394-106513416 TTCTCTGGTCTGTCCGGGGCTGG - Intergenic
938171054 2:129077033-129077055 TTCTCTGGTTGGTCCTGAGTTGG + Intergenic
938977816 2:136495951-136495973 TCCTCTGGTTTGTCCTGAGTTGG + Intergenic
939340807 2:140894291-140894313 TTCTCCAGTTTTTGAGGAGGAGG - Intronic
940259480 2:151765353-151765375 GCCTCAGGTTTTTCCTGAGGTGG - Intergenic
941808347 2:169732547-169732569 TTCTCTGGTTGGTGCAGAGGTGG + Intronic
942673992 2:178407263-178407285 TTCTCTGGTTGGTCCTGAGTTGG + Intergenic
944886184 2:204064820-204064842 TTCTCTGGTTGATCCTGAGTTGG + Intergenic
946128754 2:217587751-217587773 TTCCATGGTTTTGCTGGAGGTGG - Intronic
946473956 2:219990155-219990177 TTTTCTGGATTATCTGGAGGAGG - Intergenic
948574395 2:238940479-238940501 TTCTCTGGTTGGTCCGAAGTTGG - Intergenic
1169228999 20:3874611-3874633 TTCTCTGGTTGGTCTGGAGTTGG + Exonic
1170766312 20:19292337-19292359 TTCTCTGGTTTTTAGGGCGTGGG + Intronic
1173378639 20:42514995-42515017 TTCTCTGATTTTTACAGAAGAGG - Intronic
1175374868 20:58517118-58517140 GTCTCTGGGCTTTCCGGATGTGG + Intergenic
1175427362 20:58877155-58877177 TTTTCCGGTTTTTACAGAGGAGG + Intronic
1180749329 22:18113485-18113507 TTCTGTGGTTTATGGGGAGGTGG + Intronic
1183072289 22:35404770-35404792 TTCTCTCGTTCAGCCGGAGGAGG + Intronic
1183079603 22:35448023-35448045 TTCCCTGGTTTCTCCCCAGGTGG + Intergenic
1183367716 22:37416123-37416145 GGCTCTGGTTTTTACGGTGGAGG - Intronic
1183534243 22:38387288-38387310 CTCTCTAGTTTTTGAGGAGGTGG - Intronic
1183696875 22:39428581-39428603 TTCTCTGGTTTTGGGGCAGGGGG + Intronic
1183790707 22:40066422-40066444 TTCTTTGGAATTTCCGTAGGGGG + Intronic
1185053191 22:48564341-48564363 TTCTCTGGTTGGTCCTGAGTTGG + Intronic
949919874 3:8992196-8992218 TTCTATGTTTTTTCCAGTGGAGG - Intronic
952787478 3:37169950-37169972 TTTTCTTTTTTTTCCCGAGGAGG + Intronic
955368387 3:58331163-58331185 TTTTTTTGTTTTTCCGGAGACGG + Intergenic
955894996 3:63689390-63689412 TTCTCTGGTTTGTCCTAAGTGGG + Intergenic
957972344 3:87398749-87398771 TTTTCTGGATTTTCTGGTGGAGG + Intergenic
961507683 3:127381474-127381496 TTCTCTGGGTATTTTGGAGGAGG - Intergenic
962013927 3:131421460-131421482 TTCTCTGGTTGGTCCTGAGTTGG + Intergenic
962057517 3:131887580-131887602 TTCTCTATTATTTCCAGAGGTGG + Intronic
966233204 3:177671695-177671717 TTCTCTGGATTCCCAGGAGGAGG + Intergenic
969018297 4:4120245-4120267 TTCTCCTGTTTGTCCTGAGGAGG + Intergenic
969794903 4:9519928-9519950 TTCTCCTGTTTGTCCTGAGGAGG - Intergenic
971694473 4:29881521-29881543 TTCTCTGGTTTCTCCAGTTGAGG - Intergenic
971783623 4:31071875-31071897 TTTTCTGGTTATTCTGAAGGTGG + Intronic
972629316 4:40829635-40829657 GTCTCTTGCTTTTCAGGAGGAGG - Intronic
973991629 4:56414201-56414223 TTTTCTGGTTTTTCCTATGGCGG + Intronic
974080543 4:57207930-57207952 TTCTCTGGGTTTTCTGTGGGTGG - Intergenic
975110112 4:70613943-70613965 TTCTTTCATTTTTCCTGAGGAGG - Intergenic
975482475 4:74896731-74896753 TTCTCTGGTTGCTCCTGAGTTGG + Intergenic
977062808 4:92276668-92276690 TTCTCTGCTTTTTTGGGAGAGGG - Intergenic
977282418 4:95057670-95057692 TTGTCTGGTTTTTCTAGAAGAGG + Intronic
978448151 4:108800822-108800844 TTCTCTGGATTTTCCAGTGTTGG - Intergenic
980184460 4:129444838-129444860 TTCTCAAGTTTTGCCTGAGGTGG + Intergenic
984948224 4:184986547-184986569 TTCTCTGGCTTGTGCGGAGATGG + Intergenic
985151985 4:186956372-186956394 TTCTCTTGTTTTTCCTAAGTGGG + Intergenic
985654811 5:1124902-1124924 TTCTCTGGATTTTGCTGAAGCGG - Intergenic
985979868 5:3453560-3453582 TACTTTGCTTTTTCCAGAGGTGG - Intergenic
987022766 5:13891588-13891610 ATCTGTGGTTTTACAGGAGGAGG - Intronic
989686381 5:44092310-44092332 TGCTCTAGTTTTTCCAGGGGGGG - Intergenic
990650766 5:57897113-57897135 TTTTCTGGTTCTGCGGGAGGAGG + Intergenic
991154677 5:63417987-63418009 TTCTCAGGTCTTTCCTGAGCAGG - Intergenic
993392076 5:87331329-87331351 TTCTCTGTTTTTCCCCTAGGTGG + Exonic
993623439 5:90193850-90193872 TTCTCTGGATTACCAGGAGGAGG - Intergenic
995963304 5:117872274-117872296 TTCTCTGGTTTGTTCTGAGTTGG - Intergenic
996315137 5:122152881-122152903 TTCTCTGGTGTACCAGGAGGCGG - Exonic
996345158 5:122479450-122479472 TTCTATGGTTTTTCCGAGGTGGG - Intergenic
996352612 5:122562274-122562296 TTCTCTGGGTTTGGCTGAGGAGG + Intergenic
999269615 5:150289168-150289190 TTCTCTAGTTTTGCTTGAGGTGG - Intronic
999876178 5:155808532-155808554 TTCACTGGATTTTCCAGAAGAGG - Intergenic
1001882227 5:175254355-175254377 TTCTCTGGTTGGTCCTGAGTTGG + Intergenic
1002098916 5:176847854-176847876 TTCTCTGGTTTTGGCGGGGGAGG - Intronic
1004332455 6:14734335-14734357 TTCTCTGGTTTGTCCTAAGTTGG - Intergenic
1005354657 6:24970523-24970545 TTCTCGGGTTCCTCCTGAGGAGG - Intronic
1005903337 6:30238544-30238566 TTCTCTGCTTTTTGCTCAGGTGG - Intergenic
1008772293 6:54992907-54992929 TTCTCTGGTATTTCAGGTGATGG - Intergenic
1010480679 6:76349209-76349231 TTCTCAGGTTTTTCTGAGGGCGG + Intergenic
1010967410 6:82227299-82227321 TTCTCTTGTTTTCCCTTAGGTGG - Exonic
1011447851 6:87462039-87462061 TTCTCTGGTTGGTCCTGAGTTGG + Intronic
1012412372 6:98973525-98973547 TTCTCTGGTTGGTCCTGAGTTGG + Intergenic
1014004154 6:116397605-116397627 TTCTGTGGTTATGCCTGAGGAGG - Intronic
1015955418 6:138593086-138593108 TTCTCTGGTTTGTGTGGAAGTGG - Intronic
1019517829 7:1447524-1447546 TTCTCTGGGTTTTCCACCGGGGG - Intronic
1020019595 7:4855267-4855289 TTCTCTGGTATTTCTCGTGGTGG - Intronic
1020850524 7:13347240-13347262 TACTCTGGTTTCTCGGGAGATGG + Intergenic
1022023461 7:26423647-26423669 TTGTTTGGTTTTTCCCCAGGAGG + Intergenic
1026251502 7:68675006-68675028 TTCTCTGATTTTTCAGTTGGTGG - Intergenic
1028781623 7:94743990-94744012 TTCTCTGGTTGGTCCCGAGTTGG - Intergenic
1028837397 7:95390028-95390050 TTGACTGGTTTACCCGGAGGTGG + Intronic
1029076775 7:97940953-97940975 TTCTCCTGTTTGTCCTGAGGAGG + Intergenic
1029590148 7:101502001-101502023 TTCCCTGGTCTTTCCAGAGATGG + Intronic
1031306757 7:120137834-120137856 TAATCTGGTTTTTCTGCAGGTGG + Intergenic
1033546455 7:142405688-142405710 TTCTCTGAGTTCTCCTGAGGAGG - Intergenic
1034719817 7:153280910-153280932 TTCTCTGGTTGGTCTGGAGTAGG + Intergenic
1035219133 7:157395106-157395128 TTCTGGGGTTTTTTGGGAGGTGG - Intronic
1036827239 8:11986869-11986891 TACTCTGGTTTCTCCGGACATGG - Intergenic
1037863927 8:22427734-22427756 TTCTCTTGATTTTCAAGAGGGGG - Intronic
1039475761 8:37838701-37838723 ATCTCTGGTTTTTCAGGCTGAGG + Intronic
1039841799 8:41298919-41298941 TTCTGAGGTTTTTCTGGAGGTGG - Intronic
1040717567 8:50275902-50275924 TGCTCTGGTTTCTCTTGAGGAGG + Intronic
1040951095 8:52939761-52939783 TTCTCTGGTTTTTCCGGAGGAGG - Exonic
1045310800 8:101000623-101000645 TTCTCTGTTATTTCAGGAGATGG + Intergenic
1046751265 8:117929551-117929573 TTCTTTGGTTTTGGAGGAGGAGG - Intronic
1047202897 8:122781536-122781558 TTCGCCGGTGTCTCCGGAGGGGG + Exonic
1047211076 8:122840986-122841008 TTCTCTGTGTTTTCCGGGTGTGG - Intronic
1051443576 9:17115035-17115057 TTCTCTGATTTTTCCCAAGTTGG + Intergenic
1057611772 9:96550892-96550914 TTGACTGGTTTTTCTGGAAGTGG + Intronic
1057951958 9:99376339-99376361 TTTTTTTTTTTTTCCGGAGGAGG - Intergenic
1058855648 9:109059152-109059174 TTATCTGGTTTTTCAGCAGATGG + Intronic
1190789120 X:53683366-53683388 TACCCTGGTTTTTCTCGAGGTGG - Intronic
1196756278 X:119160191-119160213 TTCTCTGGTTATTCCTGAGTTGG - Intergenic
1196768658 X:119272246-119272268 TGCTCTGGTTTTTTGGGAGGAGG - Intergenic
1198127077 X:133655966-133655988 TTTTCTGGTGTTTACAGAGGGGG + Intronic
1199788652 X:151128968-151128990 TTCTCTGGCTTGTCAGCAGGTGG - Intergenic
1201125270 Y:10907400-10907422 TTCTAGGCTTTTCCCGGAGGAGG + Intergenic
1202177900 Y:22114418-22114440 TTTTCAGGTTTCTCTGGAGGGGG + Intergenic
1202213461 Y:22471977-22471999 TTTTCAGGTTTCTCTGGAGGGGG - Intergenic