ID: 1040955808

View in Genome Browser
Species Human (GRCh38)
Location 8:52978733-52978755
Sequence CAGTTTCAACAGATTGGGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040955803_1040955808 22 Left 1040955803 8:52978688-52978710 CCATTATAACTAAAGTCTGTCTA No data
Right 1040955808 8:52978733-52978755 CAGTTTCAACAGATTGGGGCTGG No data
1040955802_1040955808 28 Left 1040955802 8:52978682-52978704 CCAGTACCATTATAACTAAAGTC No data
Right 1040955808 8:52978733-52978755 CAGTTTCAACAGATTGGGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040955808 Original CRISPR CAGTTTCAACAGATTGGGGC TGG Intergenic
No off target data available for this crispr