ID: 1040957879

View in Genome Browser
Species Human (GRCh38)
Location 8:52997868-52997890
Sequence CCTTCAGATGGGTTTGCAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040957873_1040957879 -9 Left 1040957873 8:52997854-52997876 CCCCTAATTAGTGGCCTTCAGAT No data
Right 1040957879 8:52997868-52997890 CCTTCAGATGGGTTTGCAGTTGG No data
1040957874_1040957879 -10 Left 1040957874 8:52997855-52997877 CCCTAATTAGTGGCCTTCAGATG No data
Right 1040957879 8:52997868-52997890 CCTTCAGATGGGTTTGCAGTTGG No data
1040957870_1040957879 25 Left 1040957870 8:52997820-52997842 CCAACATTTCTGCAAAGCTGGAG No data
Right 1040957879 8:52997868-52997890 CCTTCAGATGGGTTTGCAGTTGG No data
1040957872_1040957879 -8 Left 1040957872 8:52997853-52997875 CCCCCTAATTAGTGGCCTTCAGA No data
Right 1040957879 8:52997868-52997890 CCTTCAGATGGGTTTGCAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040957879 Original CRISPR CCTTCAGATGGGTTTGCAGT TGG Intergenic