ID: 1040958007

View in Genome Browser
Species Human (GRCh38)
Location 8:52999743-52999765
Sequence CTGACTATACAAATGGGAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040958000_1040958007 11 Left 1040958000 8:52999709-52999731 CCTTAGAGATCACAAATCAGAAG No data
Right 1040958007 8:52999743-52999765 CTGACTATACAAATGGGAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040958007 Original CRISPR CTGACTATACAAATGGGAAA TGG Intergenic
No off target data available for this crispr