ID: 1040959182

View in Genome Browser
Species Human (GRCh38)
Location 8:53012993-53013015
Sequence GACTAACCTTTGGCACAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040959180_1040959182 -1 Left 1040959180 8:53012971-53012993 CCAGCTAGTTTAAAACAACAAAG No data
Right 1040959182 8:53012993-53013015 GACTAACCTTTGGCACAGCCAGG No data
1040959179_1040959182 10 Left 1040959179 8:53012960-53012982 CCATCACTGCTCCAGCTAGTTTA No data
Right 1040959182 8:53012993-53013015 GACTAACCTTTGGCACAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040959182 Original CRISPR GACTAACCTTTGGCACAGCC AGG Intergenic
No off target data available for this crispr